\
| Variant ID: vg0922421758 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22421758 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, A: 0.18, others allele: 0.00, population size: 99. )
TACTTTAATTTACCAAATTTTAAGGGAAACTATTTTGATTTCTCGAGTAGAGTAGATGTTCCCTCGTTATTTACATATCACTTAAATAATTATATTTTTT[A/T]
AAAAAAATTGAGAAGATGTATTAACATGTTATATCACTTCACAGACATCTAAGTTTAAATTCAACTCTATATCTCGCATCGAAAAAAAAATCAAATTAAA
TTTAATTTGATTTTTTTTTCGATGCGAGATATAGAGTTGAATTTAAACTTAGATGTCTGTGAAGTGATATAACATGTTAATACATCTTCTCAATTTTTTT[T/A]
AAAAAATATAATTATTTAAGTGATATGTAAATAACGAGGGAACATCTACTCTACTCGAGAAATCAAAATAGTTTCCCTTAAAATTTGGTAAATTAAAGTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.60% | 42.80% | 3.66% | 0.00% | NA |
| All Indica | 2759 | 35.40% | 60.50% | 4.02% | 0.00% | NA |
| All Japonica | 1512 | 90.70% | 5.80% | 3.44% | 0.00% | NA |
| Aus | 269 | 12.30% | 86.20% | 1.49% | 0.00% | NA |
| Indica I | 595 | 40.30% | 53.90% | 5.71% | 0.00% | NA |
| Indica II | 465 | 24.90% | 72.90% | 2.15% | 0.00% | NA |
| Indica III | 913 | 35.20% | 62.80% | 2.08% | 0.00% | NA |
| Indica Intermediate | 786 | 38.30% | 55.60% | 6.11% | 0.00% | NA |
| Temperate Japonica | 767 | 88.00% | 6.90% | 5.08% | 0.00% | NA |
| Tropical Japonica | 504 | 97.20% | 1.80% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.90% | 10.80% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 26.70% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922421758 | A -> T | LOC_Os09g39050.1 | upstream_gene_variant ; 1665.0bp to feature; MODIFIER | silent_mutation | Average:65.179; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0922421758 | A -> T | LOC_Os09g39060.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.179; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922421758 | NA | 8.49E-06 | mr1169 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922421758 | 8.93E-17 | NA | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922421758 | 4.02E-15 | 1.30E-16 | mr1865 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922421758 | 1.76E-18 | NA | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922421758 | 4.38E-15 | 4.30E-16 | mr1865_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |