Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922417122:

Variant ID: vg0922417122 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22417122
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGAGCTTAGGATGAAGCTACTGTTCTAATAATATATATAAAATATAACACCAAGCCCTATATTGTAACCAACTATGTACATATATTTGATACAAAAAC[T/C]
ATAACACGTCAAATCCGCTCCGACCTCCAATCAACCACCCGTCGATCTAGCCGCAAGCCTAAGCCAACAAATCTCCGTGCCGTCTTTCCAGCCGTTGGAC

Reverse complement sequence

GTCCAACGGCTGGAAAGACGGCACGGAGATTTGTTGGCTTAGGCTTGCGGCTAGATCGACGGGTGGTTGATTGGAGGTCGGAGCGGATTTGACGTGTTAT[A/G]
GTTTTTGTATCAAATATATGTACATAGTTGGTTACAATATAGGGCTTGGTGTTATATTTTATATATATTATTAGAACAGTAGCTTCATCCTAAGCTCTCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.60%	12.40%	0.04%	0.00%	NA
All Indica	2759	78.90%	21.00%	0.07%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	63.00%	36.80%	0.17%	0.00%	NA
Indica II	465	86.00%	14.00%	0.00%	0.00%	NA
Indica III	913	87.30%	12.70%	0.00%	0.00%	NA
Indica Intermediate	786	77.10%	22.80%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922417122	T -> C	LOC_Os09g39034.1	upstream_gene_variant ; 2752.0bp to feature; MODIFIER	silent_mutation	Average:68.713; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0922417122	T -> C	LOC_Os09g39034.2	upstream_gene_variant ; 2752.0bp to feature; MODIFIER	silent_mutation	Average:68.713; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0922417122	T -> C	LOC_Os09g39050.1	downstream_gene_variant ; 1522.0bp to feature; MODIFIER	silent_mutation	Average:68.713; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0922417122	T -> C	LOC_Os09g39060.1	downstream_gene_variant ; 3776.0bp to feature; MODIFIER	silent_mutation	Average:68.713; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N
vg0922417122	T -> C	LOC_Os09g39034-LOC_Os09g39050	intergenic_region ; MODIFIER	silent_mutation	Average:68.713; most accessible tissue: Minghui63 panicle, score: 86.012	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922417122	NA	3.40E-06	mr1229	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922417122	NA	5.36E-06	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922417122	NA	4.65E-06	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922417122	NA	1.25E-06	mr1706	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922417122	3.17E-17	NA	mr1865	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922417122	1.26E-19	4.10E-23	mr1865	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922417122	5.10E-15	NA	mr1865_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922417122	1.10E-16	9.68E-23	mr1865_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922417122	NA	8.08E-07	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251