\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922416727:

Variant ID: vg0922416727 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22416727
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAATGCAATGATGAATTCAAATATTGAAGCAGCTAACATAATTACTATTATTTAAAAAAAAAGGCAAGAAAATTCCAGAACATATATACAACAAAAAAAA[C/A]
ACGACCACGATGGGACTCGAACCCACAATCTCCCGCTCCGGAGGCGAGCGCCTTATCCATTAGGCCACGCGGTCATCTTGCCAGAAAGTCCTGACTAATA

Reverse complement sequence

TATTAGTCAGGACTTTCTGGCAAGATGACCGCGTGGCCTAATGGATAAGGCGCTCGCCTCCGGAGCGGGAGATTGTGGGTTCGAGTCCCATCGTGGTCGT[G/T]
TTTTTTTTGTTGTATATATGTTCTGGAATTTTCTTGCCTTTTTTTTTAAATAATAGTAATTATGTTAGCTGCTTCAATATTTGAATTCATCATTGCATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 27.30% 0.42% 0.00% NA
All Indica  2759 55.30% 44.00% 0.72% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 79.60% 20.40% 0.00% 0.00% NA
Indica I  595 50.60% 48.90% 0.50% 0.00% NA
Indica II  465 51.00% 49.00% 0.00% 0.00% NA
Indica III  913 58.60% 41.10% 0.33% 0.00% NA
Indica Intermediate  786 57.50% 40.70% 1.78% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922416727 C -> A LOC_Os09g39034.1 upstream_gene_variant ; 2357.0bp to feature; MODIFIER silent_mutation Average:83.136; most accessible tissue: Minghui63 flag leaf, score: 90.174 N N N N
vg0922416727 C -> A LOC_Os09g39034.2 upstream_gene_variant ; 2357.0bp to feature; MODIFIER silent_mutation Average:83.136; most accessible tissue: Minghui63 flag leaf, score: 90.174 N N N N
vg0922416727 C -> A LOC_Os09g39050.1 downstream_gene_variant ; 1917.0bp to feature; MODIFIER silent_mutation Average:83.136; most accessible tissue: Minghui63 flag leaf, score: 90.174 N N N N
vg0922416727 C -> A LOC_Os09g39060.1 downstream_gene_variant ; 4171.0bp to feature; MODIFIER silent_mutation Average:83.136; most accessible tissue: Minghui63 flag leaf, score: 90.174 N N N N
vg0922416727 C -> A LOC_Os09g39034-LOC_Os09g39050 intergenic_region ; MODIFIER silent_mutation Average:83.136; most accessible tissue: Minghui63 flag leaf, score: 90.174 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0922416727 C A 0.09 0.09 0.09 0.04 0.06 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922416727 NA 5.99E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 3.90E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 8.09E-16 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 8.43E-41 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 1.75E-43 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 6.00E-58 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 7.79E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 8.04E-20 1.07E-93 mr1865 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 2.62E-39 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 2.70E-14 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 3.35E-27 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 1.88E-25 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 5.52E-40 mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 3.29E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 5.80E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 4.03E-50 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 3.96E-24 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 1.67E-25 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 9.57E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 8.38E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 1.86E-31 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 9.94E-77 mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 3.42E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 2.98E-14 2.31E-104 mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 6.48E-35 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 1.15E-21 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922416727 NA 8.83E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251