\
| Variant ID: vg0922415488 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 22415488 |
| Reference Allele: T | Alternative Allele: C,TCTCC |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 96. )
GCTCATGGAGGAGGAGGAGGAGGAGGAAGACATCATCTCTCCTCTTTTTTTTTTTTTCTTCTTCTTGATGTCTCCTCTCCTCTCCTCTCCTCCCTCCCTC[T/C,TCTCC]
CTCTCTCTCTCTGCCTCGCTCGCTGCTGCTTTTATACAAGAAGAGAAGCAAGCCTCCCTTGAAGAAGAAGAAGAAGCAGCATGCGCTGCTTGCCGTTGCA
TGCAACGGCAAGCAGCGCATGCTGCTTCTTCTTCTTCTTCAAGGGAGGCTTGCTTCTCTTCTTGTATAAAAGCAGCAGCGAGCGAGGCAGAGAGAGAGAG[A/G,GGAGA]
GAGGGAGGGAGGAGAGGAGAGGAGAGGAGACATCAAGAAGAAGAAAAAAAAAAAAAGAGGAGAGATGATGTCTTCCTCCTCCTCCTCCTCCTCCATGAGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.10% | 28.00% | 0.95% | 0.00% | TCTCC: 0.02% |
| All Indica | 2759 | 53.40% | 45.10% | 1.49% | 0.00% | TCTCC: 0.04% |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 77.00% | 21.60% | 1.49% | 0.00% | NA |
| Indica I | 595 | 46.90% | 49.90% | 3.19% | 0.00% | NA |
| Indica II | 465 | 49.90% | 49.50% | 0.65% | 0.00% | NA |
| Indica III | 913 | 57.20% | 41.50% | 1.20% | 0.00% | TCTCC: 0.11% |
| Indica Intermediate | 786 | 55.90% | 43.10% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922415488 | T -> TCTCC | LOC_Os09g39034.1 | upstream_gene_variant ; 1119.0bp to feature; MODIFIER | silent_mutation | Average:67.927; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| vg0922415488 | T -> TCTCC | LOC_Os09g39034.2 | upstream_gene_variant ; 1119.0bp to feature; MODIFIER | silent_mutation | Average:67.927; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| vg0922415488 | T -> TCTCC | LOC_Os09g39050.1 | downstream_gene_variant ; 3155.0bp to feature; MODIFIER | silent_mutation | Average:67.927; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| vg0922415488 | T -> TCTCC | LOC_Os09g39034-LOC_Os09g39050 | intergenic_region ; MODIFIER | silent_mutation | Average:67.927; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| vg0922415488 | T -> C | LOC_Os09g39034.1 | upstream_gene_variant ; 1118.0bp to feature; MODIFIER | silent_mutation | Average:67.927; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| vg0922415488 | T -> C | LOC_Os09g39034.2 | upstream_gene_variant ; 1118.0bp to feature; MODIFIER | silent_mutation | Average:67.927; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| vg0922415488 | T -> C | LOC_Os09g39050.1 | downstream_gene_variant ; 3156.0bp to feature; MODIFIER | silent_mutation | Average:67.927; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| vg0922415488 | T -> C | LOC_Os09g39034-LOC_Os09g39050 | intergenic_region ; MODIFIER | silent_mutation | Average:67.927; most accessible tissue: Zhenshan97 flag leaf, score: 78.259 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922415488 | 4.96E-17 | NA | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922415488 | 2.85E-16 | 4.66E-17 | mr1865 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922415488 | 2.68E-18 | NA | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922415488 | 2.15E-17 | 3.25E-19 | mr1865_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |