Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922415488:

Variant ID: vg0922415488 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 22415488
Reference Allele: T	Alternative Allele: C,TCTCC
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

GCTCATGGAGGAGGAGGAGGAGGAGGAAGACATCATCTCTCCTCTTTTTTTTTTTTTCTTCTTCTTGATGTCTCCTCTCCTCTCCTCTCCTCCCTCCCTC[T/C,TCTCC]
CTCTCTCTCTCTGCCTCGCTCGCTGCTGCTTTTATACAAGAAGAGAAGCAAGCCTCCCTTGAAGAAGAAGAAGAAGCAGCATGCGCTGCTTGCCGTTGCA

Reverse complement sequence

TGCAACGGCAAGCAGCGCATGCTGCTTCTTCTTCTTCTTCAAGGGAGGCTTGCTTCTCTTCTTGTATAAAAGCAGCAGCGAGCGAGGCAGAGAGAGAGAG[A/G,GGAGA]
GAGGGAGGGAGGAGAGGAGAGGAGAGGAGACATCAAGAAGAAGAAAAAAAAAAAAAGAGGAGAGATGATGTCTTCCTCCTCCTCCTCCTCCTCCATGAGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.10%	28.00%	0.95%	0.00%	TCTCC: 0.02%
All Indica	2759	53.40%	45.10%	1.49%	0.00%	TCTCC: 0.04%
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	77.00%	21.60%	1.49%	0.00%	NA
Indica I	595	46.90%	49.90%	3.19%	0.00%	NA
Indica II	465	49.90%	49.50%	0.65%	0.00%	NA
Indica III	913	57.20%	41.50%	1.20%	0.00%	TCTCC: 0.11%
Indica Intermediate	786	55.90%	43.10%	1.02%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922415488	T -> TCTCC	LOC_Os09g39034.1	upstream_gene_variant ; 1119.0bp to feature; MODIFIER	silent_mutation	Average:67.927; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg0922415488	T -> TCTCC	LOC_Os09g39034.2	upstream_gene_variant ; 1119.0bp to feature; MODIFIER	silent_mutation	Average:67.927; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg0922415488	T -> TCTCC	LOC_Os09g39050.1	downstream_gene_variant ; 3155.0bp to feature; MODIFIER	silent_mutation	Average:67.927; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg0922415488	T -> TCTCC	LOC_Os09g39034-LOC_Os09g39050	intergenic_region ; MODIFIER	silent_mutation	Average:67.927; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg0922415488	T -> C	LOC_Os09g39034.1	upstream_gene_variant ; 1118.0bp to feature; MODIFIER	silent_mutation	Average:67.927; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg0922415488	T -> C	LOC_Os09g39034.2	upstream_gene_variant ; 1118.0bp to feature; MODIFIER	silent_mutation	Average:67.927; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg0922415488	T -> C	LOC_Os09g39050.1	downstream_gene_variant ; 3156.0bp to feature; MODIFIER	silent_mutation	Average:67.927; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg0922415488	T -> C	LOC_Os09g39034-LOC_Os09g39050	intergenic_region ; MODIFIER	silent_mutation	Average:67.927; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922415488	4.96E-17	NA	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922415488	2.85E-16	4.66E-17	mr1865	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922415488	2.68E-18	NA	mr1865_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922415488	2.15E-17	3.25E-19	mr1865_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251