\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922414567:

Variant ID: vg0922414567 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 22414567
Reference Allele: TAAGAAGAlternative Allele: GAAGAAG,TAAGAAGAAGAAG,TAAGAAGAAGAAGAAG,TAAGAAGAAG,TAAG,T
Primary Allele: GAAGAAGSecondary Allele: TAAGAAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCCATAAAAAAGGCCCATGTACTCTCGCAACTCTTCTTCTTTTTTATTTTTCCCGTCGTACGTGCATGCGTGCATATGCAAGATGAATAATAATAATAA[TAAGAAG/GAAGAAG,TAAGAAGAAGAAG,TAAGAAGAAGAAGAAG,TAAGAAGAAG,TAAG,T]
AAGAAGAAGATCAAGATGCATATGCGTGCGTTGCTAATCCCTTCTTCCGTAGAGAATATAGTATACGAAACAGTGTGCAGTTTGTACAACAACAACAAAA

Reverse complement sequence

TTTTGTTGTTGTTGTACAAACTGCACACTGTTTCGTATACTATATTCTCTACGGAAGAAGGGATTAGCAACGCACGCATATGCATCTTGATCTTCTTCTT[CTTCTTA/CTTCTTC,CTTCTTCTTCTTA,CTTCTTCTTCTTCTTA,CTTCTTCTTA,CTTA,A]
TTATTATTATTATTCATCTTGCATATGCACGCATGCACGTACGACGGGAAAAATAAAAAAGAAGAAGAGTTGCGAGAGTACATGGGCCTTTTTTATGGGC

Allele Frequencies:

Populations Population SizeFrequency of GAAGAAG(primary allele) Frequency of TAAGAAG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.00% 41.80% 2.56% 0.00% TAAGAAGAAGAAG: 0.19%; TAAGAAGAAGAAGAAG: 0.17%; TAAG: 0.15%; T: 0.11%; TAAGAAGAAG: 0.06%
All Indica  2759 69.20% 28.90% 0.91% 0.00% TAAGAAGAAGAAGAAG: 0.29%; TAAGAAGAAGAAG: 0.29%; TAAG: 0.25%; T: 0.18%
All Japonica  1512 25.20% 69.20% 5.42% 0.00% TAAGAAGAAG: 0.07%; TAAGAAGAAGAAG: 0.07%
Aus  269 95.50% 2.20% 1.86% 0.00% TAAGAAGAAG: 0.37%
Indica I  595 93.40% 5.00% 0.34% 0.00% TAAGAAGAAGAAG: 0.67%; TAAGAAGAAGAAGAAG: 0.50%
Indica II  465 63.20% 34.00% 1.29% 0.00% T: 1.08%; TAAGAAGAAGAAGAAG: 0.22%; TAAGAAGAAGAAG: 0.22%
Indica III  913 57.30% 42.30% 0.33% 0.00% TAAGAAGAAGAAGAAG: 0.11%
Indica Intermediate  786 68.30% 28.20% 1.78% 0.00% TAAG: 0.89%; TAAGAAGAAGAAGAAG: 0.38%; TAAGAAGAAGAAG: 0.38%
Temperate Japonica  767 3.40% 90.60% 6.00% 0.00% NA
Tropical Japonica  504 65.30% 30.20% 4.17% 0.00% TAAGAAGAAGAAG: 0.20%; TAAGAAGAAG: 0.20%
Japonica Intermediate  241 10.80% 83.00% 6.22% 0.00% NA
VI/Aromatic  96 7.30% 90.60% 1.04% 0.00% TAAGAAGAAG: 1.04%
Intermediate  90 48.90% 42.20% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922414567 TAAGAAG -> T LOC_Os09g39034.1 upstream_gene_variant ; 198.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> T LOC_Os09g39034.2 upstream_gene_variant ; 198.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> T LOC_Os09g39050.1 downstream_gene_variant ; 4076.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> T LOC_Os09g39034-LOC_Os09g39050 intergenic_region ; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> TAAGAAGAAGAAGAAG LOC_Os09g39034.1 upstream_gene_variant ; 204.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> TAAGAAGAAGAAGAAG LOC_Os09g39034.2 upstream_gene_variant ; 204.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> TAAGAAGAAGAAGAAG LOC_Os09g39050.1 downstream_gene_variant ; 4070.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> TAAGAAGAAGAAGAAG LOC_Os09g39034-LOC_Os09g39050 intergenic_region ; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> GAAGAAG LOC_Os09g39034.1 upstream_gene_variant ; 197.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> GAAGAAG LOC_Os09g39034.2 upstream_gene_variant ; 197.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> GAAGAAG LOC_Os09g39050.1 downstream_gene_variant ; 4077.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> GAAGAAG LOC_Os09g39034-LOC_Os09g39050 intergenic_region ; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> TAAG LOC_Os09g39034.1 upstream_gene_variant ; 201.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> TAAG LOC_Os09g39034.2 upstream_gene_variant ; 201.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> TAAG LOC_Os09g39050.1 downstream_gene_variant ; 4073.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> TAAG LOC_Os09g39034-LOC_Os09g39050 intergenic_region ; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> TAAGAAGAAG LOC_Os09g39034.1 upstream_gene_variant ; 204.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> TAAGAAGAAG LOC_Os09g39034.2 upstream_gene_variant ; 204.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> TAAGAAGAAG LOC_Os09g39050.1 downstream_gene_variant ; 4070.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> TAAGAAGAAG LOC_Os09g39034-LOC_Os09g39050 intergenic_region ; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> TAAGAAGAAGAAG LOC_Os09g39034.1 upstream_gene_variant ; 204.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> TAAGAAGAAGAAG LOC_Os09g39034.2 upstream_gene_variant ; 204.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> TAAGAAGAAGAAG LOC_Os09g39050.1 downstream_gene_variant ; 4070.0bp to feature; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N
vg0922414567 TAAGAAG -> TAAGAAGAAGAAG LOC_Os09g39034-LOC_Os09g39050 intergenic_region ; MODIFIER silent_mutation Average:88.476; most accessible tissue: Callus, score: 98.697 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0922414567 TAAGA* GAAGA* -0.01 -0.02 -0.03 -0.02 -0.02 -0.02
vg0922414567 TAAGA* T -0.02 -0.19 -0.29 -0.11 -0.15 -0.23
vg0922414567 TAAGA* TAAG -0.24 -0.19 -0.19 -0.16 -0.19 -0.24
vg0922414567 TAAGA* TAAGA* 0.05 0.11 0.01 0.17 0.06 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922414567 NA 3.74E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 7.43E-08 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 1.36E-11 mr1275 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 7.55E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 2.17E-17 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 2.20E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 1.26E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 2.54E-09 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 6.38E-06 2.75E-07 mr1407 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 6.20E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 4.87E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 5.97E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 9.36E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 4.73E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 4.32E-09 mr1606 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 3.73E-11 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 1.11E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 1.47E-06 mr1665 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 1.22E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 5.01E-10 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 7.46E-12 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 3.64E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 3.62E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922414567 NA 1.43E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251