Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922398401:

Variant ID: vg0922398401 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22398401
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

ACCAAATTTGTCCTAAAATAGCATTTCTCATTTGTTCTTTGTCCACAAGACAGACTGGACGGAAAACCACGTGCTTTTTAATCGACCCGATCCAAACAGA[C/T]
TGGACGGATTCCGGACATAACCAATTTTGTTCTAAAATAATATTTCTCCTTTATTCTATGTGTAAACAAAAAAAACCACGTGTTTTTTTCCAACTTGGTT

Reverse complement sequence

AACCAAGTTGGAAAAAAACACGTGGTTTTTTTTGTTTACACATAGAATAAAGGAGAAATATTATTTTAGAACAAAATTGGTTATGTCCGGAATCCGTCCA[G/A]
TCTGTTTGGATCGGGTCGATTAAAAAGCACGTGGTTTTCCGTCCAGTCTGTCTTGTGGACAAAGAACAAATGAGAAATGCTATTTTAGGACAAATTTGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.70%	22.40%	0.25%	1.67%	NA
All Indica	2759	58.90%	37.90%	0.40%	2.75%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	99.30%	0.00%	0.37%	0.37%	NA
Indica I	595	23.70%	76.10%	0.00%	0.17%	NA
Indica II	465	51.00%	42.80%	0.22%	6.02%	NA
Indica III	913	84.20%	12.70%	0.22%	2.85%	NA
Indica Intermediate	786	60.90%	35.40%	1.02%	2.67%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	11.10%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922398401	C -> DEL	N	N	silent_mutation	Average:40.548; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0922398401	C -> T	LOC_Os09g39020.1	upstream_gene_variant ; 1668.0bp to feature; MODIFIER	silent_mutation	Average:40.548; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0922398401	C -> T	LOC_Os09g39000-LOC_Os09g39020	intergenic_region ; MODIFIER	silent_mutation	Average:40.548; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922398401	NA	6.33E-06	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922398401	NA	1.60E-07	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922398401	NA	2.41E-07	mr1006_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922398401	NA	5.22E-26	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922398401	NA	2.20E-08	mr1051_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922398401	NA	6.05E-07	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251