\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922383096:

Variant ID: vg0922383096 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22383096
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.15, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTGCTAAAACCCTCATCGCCGCGCCGCCGCCTCCGCCTCTGCTCCGCCGCTCCCAACCCTGCGCGGCGGGCGGCGGTGAGCCGGTCTGCTCTTCCCTC[T/C]
ACCGGCCGCCCACGCTGCTCCTCACGGCGCTCTCGATTCCTGGTTCCTCTCCCCGTGGGCCTCCATGTCTTTGACCACCGTTTCTTTCTCATACCCCGCC

Reverse complement sequence

GGCGGGGTATGAGAAAGAAACGGTGGTCAAAGACATGGAGGCCCACGGGGAGAGGAACCAGGAATCGAGAGCGCCGTGAGGAGCAGCGTGGGCGGCCGGT[A/G]
GAGGGAAGAGCAGACCGGCTCACCGCCGCCCGCCGCGCAGGGTTGGGAGCGGCGGAGCAGAGGCGGAGGCGGCGGCGCGGCGATGAGGGTTTTAGCACAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 41.80% 0.19% 0.00% NA
All Indica  2759 91.20% 8.50% 0.33% 0.00% NA
All Japonica  1512 0.60% 99.40% 0.00% 0.00% NA
Aus  269 68.80% 31.20% 0.00% 0.00% NA
Indica I  595 97.30% 1.70% 1.01% 0.00% NA
Indica II  465 83.00% 16.80% 0.22% 0.00% NA
Indica III  913 93.20% 6.70% 0.11% 0.00% NA
Indica Intermediate  786 88.90% 10.90% 0.13% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 32.20% 67.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922383096 T -> C LOC_Os09g38980.1 5_prime_UTR_variant ; 65.0bp to feature; MODIFIER silent_mutation Average:78.914; most accessible tissue: Zhenshan97 flower, score: 87.906 N N N N
vg0922383096 T -> C LOC_Os09g38980.2 5_prime_UTR_variant ; 1349.0bp to feature; MODIFIER silent_mutation Average:78.914; most accessible tissue: Zhenshan97 flower, score: 87.906 N N N N
vg0922383096 T -> C LOC_Os09g38990.1 upstream_gene_variant ; 4658.0bp to feature; MODIFIER silent_mutation Average:78.914; most accessible tissue: Zhenshan97 flower, score: 87.906 N N N N
vg0922383096 T -> C LOC_Os09g38970.1 downstream_gene_variant ; 604.0bp to feature; MODIFIER silent_mutation Average:78.914; most accessible tissue: Zhenshan97 flower, score: 87.906 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922383096 1.02E-13 5.55E-82 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922383096 4.16E-13 1.45E-11 mr1865 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922383096 NA 8.79E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922383096 4.49E-06 6.45E-37 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922383096 NA 7.47E-21 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922383096 NA 1.10E-18 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922383096 1.68E-17 1.82E-102 mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922383096 1.32E-14 2.24E-15 mr1865_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251