\
| Variant ID: vg0922383096 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22383096 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.85, C: 0.15, others allele: 0.00, population size: 82. )
CTGTGCTAAAACCCTCATCGCCGCGCCGCCGCCTCCGCCTCTGCTCCGCCGCTCCCAACCCTGCGCGGCGGGCGGCGGTGAGCCGGTCTGCTCTTCCCTC[T/C]
ACCGGCCGCCCACGCTGCTCCTCACGGCGCTCTCGATTCCTGGTTCCTCTCCCCGTGGGCCTCCATGTCTTTGACCACCGTTTCTTTCTCATACCCCGCC
GGCGGGGTATGAGAAAGAAACGGTGGTCAAAGACATGGAGGCCCACGGGGAGAGGAACCAGGAATCGAGAGCGCCGTGAGGAGCAGCGTGGGCGGCCGGT[A/G]
GAGGGAAGAGCAGACCGGCTCACCGCCGCCCGCCGCGCAGGGTTGGGAGCGGCGGAGCAGAGGCGGAGGCGGCGGCGCGGCGATGAGGGTTTTAGCACAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.00% | 41.80% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 91.20% | 8.50% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 68.80% | 31.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 1.70% | 1.01% | 0.00% | NA |
| Indica II | 465 | 83.00% | 16.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 93.20% | 6.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 88.90% | 10.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 32.20% | 67.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922383096 | T -> C | LOC_Os09g38980.1 | 5_prime_UTR_variant ; 65.0bp to feature; MODIFIER | silent_mutation | Average:78.914; most accessible tissue: Zhenshan97 flower, score: 87.906 | N | N | N | N |
| vg0922383096 | T -> C | LOC_Os09g38980.2 | 5_prime_UTR_variant ; 1349.0bp to feature; MODIFIER | silent_mutation | Average:78.914; most accessible tissue: Zhenshan97 flower, score: 87.906 | N | N | N | N |
| vg0922383096 | T -> C | LOC_Os09g38990.1 | upstream_gene_variant ; 4658.0bp to feature; MODIFIER | silent_mutation | Average:78.914; most accessible tissue: Zhenshan97 flower, score: 87.906 | N | N | N | N |
| vg0922383096 | T -> C | LOC_Os09g38970.1 | downstream_gene_variant ; 604.0bp to feature; MODIFIER | silent_mutation | Average:78.914; most accessible tissue: Zhenshan97 flower, score: 87.906 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922383096 | 1.02E-13 | 5.55E-82 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922383096 | 4.16E-13 | 1.45E-11 | mr1865 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922383096 | NA | 8.79E-15 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922383096 | 4.49E-06 | 6.45E-37 | mr1208_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922383096 | NA | 7.47E-21 | mr1362_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922383096 | NA | 1.10E-18 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922383096 | 1.68E-17 | 1.82E-102 | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922383096 | 1.32E-14 | 2.24E-15 | mr1865_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |