\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922373958:

Variant ID: vg0922373958 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22373958
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAGTACAACCCACTACTAGCTTCGAATTATCTATAACTAATCTAATAACCAATTTATACAATACTTATTAATATATGGTCTCATCTGCCATACACACTG[T/C]
GTCTTGAAGTTCGTGCTGCAGCTGGCTACAGATCTATATCCCGCTGCTCTACGCTATCATCTTTTATCTTATTAAAATATGTTTATAGCTAACTAATAGT

Reverse complement sequence

ACTATTAGTTAGCTATAAACATATTTTAATAAGATAAAAGATGATAGCGTAGAGCAGCGGGATATAGATCTGTAGCCAGCTGCAGCACGAACTTCAAGAC[A/G]
CAGTGTGTATGGCAGATGAGACCATATATTAATAAGTATTGTATAAATTGGTTATTAGATTAGTTATAGATAATTCGAAGCTAGTAGTGGGTTGTACTAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 1.10% 9.61% 41.01% NA
All Indica  2759 19.30% 1.60% 14.28% 64.81% NA
All Japonica  1512 99.50% 0.00% 0.20% 0.33% NA
Aus  269 33.80% 2.60% 18.59% 44.98% NA
Indica I  595 22.20% 0.30% 21.85% 55.63% NA
Indica II  465 30.10% 1.30% 10.75% 57.85% NA
Indica III  913 9.70% 2.40% 10.62% 77.22% NA
Indica Intermediate  786 21.80% 1.90% 14.89% 61.45% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.00% 0.00% 0.20% 0.79% NA
Japonica Intermediate  241 99.20% 0.00% 0.41% 0.41% NA
VI/Aromatic  96 95.80% 0.00% 1.04% 3.12% NA
Intermediate  90 70.00% 0.00% 6.67% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922373958 T -> DEL N N silent_mutation Average:89.414; most accessible tissue: Zhenshan97 flower, score: 96.44 N N N N
vg0922373958 T -> C LOC_Os09g38960.2 upstream_gene_variant ; 338.0bp to feature; MODIFIER silent_mutation Average:89.414; most accessible tissue: Zhenshan97 flower, score: 96.44 N N N N
vg0922373958 T -> C LOC_Os09g38970.1 upstream_gene_variant ; 2930.0bp to feature; MODIFIER silent_mutation Average:89.414; most accessible tissue: Zhenshan97 flower, score: 96.44 N N N N
vg0922373958 T -> C LOC_Os09g38960.3 upstream_gene_variant ; 338.0bp to feature; MODIFIER silent_mutation Average:89.414; most accessible tissue: Zhenshan97 flower, score: 96.44 N N N N
vg0922373958 T -> C LOC_Os09g38960.4 upstream_gene_variant ; 338.0bp to feature; MODIFIER silent_mutation Average:89.414; most accessible tissue: Zhenshan97 flower, score: 96.44 N N N N
vg0922373958 T -> C LOC_Os09g38960-LOC_Os09g38970 intergenic_region ; MODIFIER silent_mutation Average:89.414; most accessible tissue: Zhenshan97 flower, score: 96.44 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0922373958 T C 0.0 -0.02 -0.02 0.0 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922373958 NA 2.33E-06 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958 NA 6.43E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958 NA 2.52E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958 NA 6.20E-06 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958 NA 4.90E-07 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958 NA 1.11E-06 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958 NA 1.89E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958 NA 2.79E-06 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958 NA 1.49E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958 2.99E-07 NA mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958 4.53E-06 3.27E-06 mr1865 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958 NA 4.68E-06 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958 NA 5.06E-07 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958 NA 6.63E-06 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958 NA 7.16E-07 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922373958 5.15E-06 NA mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251