\
| Variant ID: vg0922372102 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22372102 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )
CAAGGCTTTGGAAAGCTAGCCGTAGCAGTAAAATTGTTGGATAGGTCTGCATAAAGGAATTGGGGAAGAACAGTTAGCAAGAATACTTCAATGGTCCATT[C/T]
GTGAAAAAAAATCAGAATCTGTATGCCATTAAAATGTATCCTAGGCAACATCTAAAATCAACTGAACTAGTATCACCAACATCCAAGGCAATTATCAGAG
CTCTGATAATTGCCTTGGATGTTGGTGATACTAGTTCAGTTGATTTTAGATGTTGCCTAGGATACATTTTAATGGCATACAGATTCTGATTTTTTTTCAC[G/A]
AATGGACCATTGAAGTATTCTTGCTAACTGTTCTTCCCCAATTCCTTTATGCAGACCTATCCAACAATTTTACTGCTACGGCTAGCTTTCCAAAGCCTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.90% | 12.90% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 79.90% | 19.90% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.00% | 15.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 68.20% | 31.40% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 80.40% | 19.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922372102 | C -> T | LOC_Os09g38970.1 | upstream_gene_variant ; 4786.0bp to feature; MODIFIER | silent_mutation | Average:47.037; most accessible tissue: Zhenshan97 young leaf, score: 63.653 | N | N | N | N |
| vg0922372102 | C -> T | LOC_Os09g38960.2 | intron_variant ; MODIFIER | silent_mutation | Average:47.037; most accessible tissue: Zhenshan97 young leaf, score: 63.653 | N | N | N | N |
| vg0922372102 | C -> T | LOC_Os09g38960.3 | intron_variant ; MODIFIER | silent_mutation | Average:47.037; most accessible tissue: Zhenshan97 young leaf, score: 63.653 | N | N | N | N |
| vg0922372102 | C -> T | LOC_Os09g38960.4 | intron_variant ; MODIFIER | silent_mutation | Average:47.037; most accessible tissue: Zhenshan97 young leaf, score: 63.653 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922372102 | NA | 3.63E-07 | mr1003 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 4.34E-07 | mr1051 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 1.12E-08 | mr1765 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 2.69E-06 | mr1051_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 3.48E-06 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 1.92E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 8.57E-06 | mr1296_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 1.93E-06 | mr1331_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | 5.75E-06 | 2.00E-07 | mr1331_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 3.53E-07 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 6.67E-06 | mr1358_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 4.60E-06 | mr1376_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 3.74E-06 | mr1431_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 4.39E-06 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 2.60E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 2.17E-06 | mr1571_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 4.94E-11 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 2.75E-08 | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922372102 | NA | 5.59E-08 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |