Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922372102:

Variant ID: vg0922372102 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22372102
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGGCTTTGGAAAGCTAGCCGTAGCAGTAAAATTGTTGGATAGGTCTGCATAAAGGAATTGGGGAAGAACAGTTAGCAAGAATACTTCAATGGTCCATT[C/T]
GTGAAAAAAAATCAGAATCTGTATGCCATTAAAATGTATCCTAGGCAACATCTAAAATCAACTGAACTAGTATCACCAACATCCAAGGCAATTATCAGAG

Reverse complement sequence

CTCTGATAATTGCCTTGGATGTTGGTGATACTAGTTCAGTTGATTTTAGATGTTGCCTAGGATACATTTTAATGGCATACAGATTCTGATTTTTTTTCAC[G/A]
AATGGACCATTGAAGTATTCTTGCTAACTGTTCTTCCCCAATTCCTTTATGCAGACCTATCCAACAATTTTACTGCTACGGCTAGCTTTCCAAAGCCTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.90%	12.90%	0.13%	0.00%	NA
All Indica	2759	79.90%	19.90%	0.22%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	78.80%	21.20%	0.00%	0.00%	NA
Indica I	595	84.00%	15.80%	0.17%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	68.20%	31.40%	0.33%	0.00%	NA
Indica Intermediate	786	80.40%	19.30%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922372102	C -> T	LOC_Os09g38970.1	upstream_gene_variant ; 4786.0bp to feature; MODIFIER	silent_mutation	Average:47.037; most accessible tissue: Zhenshan97 young leaf, score: 63.653	N	N	N	N
vg0922372102	C -> T	LOC_Os09g38960.2	intron_variant ; MODIFIER	silent_mutation	Average:47.037; most accessible tissue: Zhenshan97 young leaf, score: 63.653	N	N	N	N
vg0922372102	C -> T	LOC_Os09g38960.3	intron_variant ; MODIFIER	silent_mutation	Average:47.037; most accessible tissue: Zhenshan97 young leaf, score: 63.653	N	N	N	N
vg0922372102	C -> T	LOC_Os09g38960.4	intron_variant ; MODIFIER	silent_mutation	Average:47.037; most accessible tissue: Zhenshan97 young leaf, score: 63.653	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922372102	NA	3.63E-07	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	4.34E-07	mr1051	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	1.12E-08	mr1765	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	2.69E-06	mr1051_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	3.48E-06	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	1.92E-06	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	8.57E-06	mr1296_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	1.93E-06	mr1331_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	5.75E-06	2.00E-07	mr1331_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	3.53E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	6.67E-06	mr1358_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	4.60E-06	mr1376_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	3.74E-06	mr1431_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	4.39E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	2.60E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	2.17E-06	mr1571_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	4.94E-11	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	2.75E-08	mr1758_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922372102	NA	5.59E-08	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251