\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922312055:

Variant ID: vg0922312055 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22312055
Reference Allele: AAlternative Allele: T,G
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTGCGCGCCGTCGACATCGCCGGCGCCGTGAACATCACGTACGACGTCGTCAGCGGAACCACCGGCAACGGCACGTGGGGCGGCGTCGCCGCGACCTCA[A/T,G]
CCAACCCGTACGTCGTCTCCGGGGAACTCAACCAGCTCCTCGTCACGGCGTGCAACATTCAGGTAACCCTTGTCGGCAGCGGCGGCAACGTCATCACCGG

Reverse complement sequence

CCGGTGATGACGTTGCCGCCGCTGCCGACAAGGGTTACCTGAATGTTGCACGCCGTGACGAGGAGCTGGTTGAGTTCCCCGGAGACGACGTACGGGTTGG[T/A,C]
TGAGGTCGCGGCGACGCCGCCCCACGTGCCGTTGCCGGTGGTTCCGCTGACGACGTCGTACGTGATGTTCACGGCGCCGGCGATGTCGACGGCGCGCAGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.10% 1.60% 3.15% 18.07% G: 0.06%
All Indica  2759 62.10% 2.60% 4.97% 30.26% G: 0.04%
All Japonica  1512 99.80% 0.00% 0.00% 0.20% NA
Aus  269 91.80% 0.40% 4.46% 3.35% NA
Indica I  595 34.50% 0.70% 9.24% 55.63% NA
Indica II  465 51.80% 7.50% 4.30% 36.34% NA
Indica III  913 84.10% 1.50% 0.99% 13.36% NA
Indica Intermediate  786 63.50% 2.50% 6.74% 27.10% G: 0.13%
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 90.00% 2.20% 0.00% 5.56% G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922312055 A -> G LOC_Os09g38840.1 missense_variant ; p.Thr131Ala; MODERATE nonsynonymous_codon ; T131A Average:64.315; most accessible tissue: Minghui63 young leaf, score: 93.727 unknown unknown TOLERATED 0.72
vg0922312055 A -> DEL LOC_Os09g38840.1 N frameshift_variant Average:64.315; most accessible tissue: Minghui63 young leaf, score: 93.727 N N N N
vg0922312055 A -> T LOC_Os09g38840.1 missense_variant ; p.Thr131Ser; MODERATE nonsynonymous_codon ; T131S Average:64.315; most accessible tissue: Minghui63 young leaf, score: 93.727 unknown unknown TOLERATED 0.71

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0922312055 A G 0.01 0.01 0.01 0.01 0.01 0.01
vg0922312055 A T 0.01 0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922312055 NA 5.83E-10 Heading_date Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652