Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0922310318:

Variant ID: vg0922310318 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22310318
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTAAACGTTGCTCCGATGTACAAGGTGCCGATGGCCTTTATGATATCCATGCATTTCATTGCTATATGTACAACAATATTTTTTTGTCGTTTATCTGA[A/G]
CATGTATTTTTCTGTATGGTTTATTCAATGTAATATATGTTCGTCGTCAAATTTTCTTGTTTACATTAGTTGAATATTTATTCGTTTGATTTGCACCATA

Reverse complement sequence

TATGGTGCAAATCAAACGAATAAATATTCAACTAATGTAAACAAGAAAATTTGACGACGAACATATATTACATTGAATAAACCATACAGAAAAATACATG[T/C]
TCAGATAAACGACAAAAAAATATTGTTGTACATATAGCAATGAAATGCATGGATATCATAAAGGCCATCGGCACCTTGTACATCGGAGCAACGTTTACTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.70%	17.40%	1.35%	0.55%	NA
All Indica	2759	67.70%	29.20%	2.17%	0.83%	NA
All Japonica	1512	99.60%	0.30%	0.07%	0.00%	NA
Aus	269	98.90%	0.00%	0.74%	0.37%	NA
Indica I	595	95.30%	4.70%	0.00%	0.00%	NA
Indica II	465	54.00%	38.70%	7.10%	0.22%	NA
Indica III	913	57.00%	39.80%	1.20%	2.08%	NA
Indica Intermediate	786	67.60%	30.00%	2.04%	0.38%	NA
Temperate Japonica	767	99.50%	0.40%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	8.90%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922310318	A -> G	LOC_Os09g38840.1	upstream_gene_variant ; 1279.0bp to feature; MODIFIER	silent_mutation	Average:55.919; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0922310318	A -> G	LOC_Os09g38830.1	downstream_gene_variant ; 4795.0bp to feature; MODIFIER	silent_mutation	Average:55.919; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0922310318	A -> G	LOC_Os09g38834.1	downstream_gene_variant ; 138.0bp to feature; MODIFIER	silent_mutation	Average:55.919; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0922310318	A -> G	LOC_Os09g38834-LOC_Os09g38840	intergenic_region ; MODIFIER	silent_mutation	Average:55.919; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0922310318	A -> DEL	N	N	silent_mutation	Average:55.919; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922310318	7.30E-07	NA	mr1008_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251