\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922310318:

Variant ID: vg0922310318 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22310318
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTAAACGTTGCTCCGATGTACAAGGTGCCGATGGCCTTTATGATATCCATGCATTTCATTGCTATATGTACAACAATATTTTTTTGTCGTTTATCTGA[A/G]
CATGTATTTTTCTGTATGGTTTATTCAATGTAATATATGTTCGTCGTCAAATTTTCTTGTTTACATTAGTTGAATATTTATTCGTTTGATTTGCACCATA

Reverse complement sequence

TATGGTGCAAATCAAACGAATAAATATTCAACTAATGTAAACAAGAAAATTTGACGACGAACATATATTACATTGAATAAACCATACAGAAAAATACATG[T/C]
TCAGATAAACGACAAAAAAATATTGTTGTACATATAGCAATGAAATGCATGGATATCATAAAGGCCATCGGCACCTTGTACATCGGAGCAACGTTTACTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 17.40% 1.35% 0.55% NA
All Indica  2759 67.70% 29.20% 2.17% 0.83% NA
All Japonica  1512 99.60% 0.30% 0.07% 0.00% NA
Aus  269 98.90% 0.00% 0.74% 0.37% NA
Indica I  595 95.30% 4.70% 0.00% 0.00% NA
Indica II  465 54.00% 38.70% 7.10% 0.22% NA
Indica III  913 57.00% 39.80% 1.20% 2.08% NA
Indica Intermediate  786 67.60% 30.00% 2.04% 0.38% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 8.90% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922310318 A -> G LOC_Os09g38840.1 upstream_gene_variant ; 1279.0bp to feature; MODIFIER silent_mutation Average:55.919; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0922310318 A -> G LOC_Os09g38830.1 downstream_gene_variant ; 4795.0bp to feature; MODIFIER silent_mutation Average:55.919; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0922310318 A -> G LOC_Os09g38834.1 downstream_gene_variant ; 138.0bp to feature; MODIFIER silent_mutation Average:55.919; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0922310318 A -> G LOC_Os09g38834-LOC_Os09g38840 intergenic_region ; MODIFIER silent_mutation Average:55.919; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0922310318 A -> DEL N N silent_mutation Average:55.919; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922310318 7.30E-07 NA mr1008_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251