\
| Variant ID: vg0922290793 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22290793 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, T: 0.09, others allele: 0.00, population size: 80. )
ATCTCAATCTCTGTTGATTCCCTCTCAGGCTTTGCATTGGGAACCCTGTGGTCAAAATAGTTATATACATACATGTAAGCAACAACATGGTAGAACATTA[A/T]
AACCGCAAATACGCAAACACGGCAGTTGTATCATTTATTTCCCACTCAGATATTGCTAGCTGAGGGGAATAACTAGACAAGGTTTGACGGCCTAGAGGAA
TTCCTCTAGGCCGTCAAACCTTGTCTAGTTATTCCCCTCAGCTAGCAATATCTGAGTGGGAAATAAATGATACAACTGCCGTGTTTGCGTATTTGCGGTT[T/A]
TAATGTTCTACCATGTTGTTGCTTACATGTATGTATATAACTATTTTGACCACAGGGTTCCCAATGCAAAGCCTGAGAGGGAATCAACAGAGATTGAGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.20% | 12.10% | 8.68% | 31.00% | NA |
| All Indica | 2759 | 15.40% | 18.60% | 14.17% | 51.79% | NA |
| All Japonica | 1512 | 99.60% | 0.00% | 0.13% | 0.26% | NA |
| Aus | 269 | 70.30% | 20.10% | 3.35% | 6.32% | NA |
| Indica I | 595 | 5.50% | 12.30% | 10.08% | 72.10% | NA |
| Indica II | 465 | 24.10% | 5.60% | 12.90% | 57.42% | NA |
| Indica III | 913 | 13.50% | 30.60% | 14.02% | 41.95% | NA |
| Indica Intermediate | 786 | 20.00% | 17.30% | 18.19% | 44.53% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 71.10% | 5.60% | 7.78% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922290793 | A -> DEL | N | N | silent_mutation | Average:57.874; most accessible tissue: Callus, score: 75.681 | N | N | N | N |
| vg0922290793 | A -> T | LOC_Os09g38784.1 | upstream_gene_variant ; 4265.0bp to feature; MODIFIER | silent_mutation | Average:57.874; most accessible tissue: Callus, score: 75.681 | N | N | N | N |
| vg0922290793 | A -> T | LOC_Os09g38800.1 | upstream_gene_variant ; 1556.0bp to feature; MODIFIER | silent_mutation | Average:57.874; most accessible tissue: Callus, score: 75.681 | N | N | N | N |
| vg0922290793 | A -> T | LOC_Os09g38790.1 | intron_variant ; MODIFIER | silent_mutation | Average:57.874; most accessible tissue: Callus, score: 75.681 | N | N | N | N |
| vg0922290793 | A -> T | LOC_Os09g38790.2 | intron_variant ; MODIFIER | silent_mutation | Average:57.874; most accessible tissue: Callus, score: 75.681 | N | N | N | N |
| vg0922290793 | A -> T | LOC_Os09g38790.3 | intron_variant ; MODIFIER | silent_mutation | Average:57.874; most accessible tissue: Callus, score: 75.681 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922290793 | NA | 2.27E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922290793 | NA | 7.43E-08 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922290793 | 3.19E-06 | NA | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922290793 | 4.63E-06 | 3.16E-45 | mr1208_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922290793 | NA | 3.91E-06 | mr1208_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922290793 | NA | 1.66E-24 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922290793 | NA | 2.07E-22 | mr1316_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922290793 | NA | 1.01E-19 | mr1362_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922290793 | NA | 9.44E-32 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922290793 | NA | 5.75E-16 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922290793 | 7.18E-10 | NA | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922290793 | 2.82E-09 | 3.40E-08 | mr1865_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |