\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922290793:

Variant ID: vg0922290793 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22290793
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, T: 0.09, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTCAATCTCTGTTGATTCCCTCTCAGGCTTTGCATTGGGAACCCTGTGGTCAAAATAGTTATATACATACATGTAAGCAACAACATGGTAGAACATTA[A/T]
AACCGCAAATACGCAAACACGGCAGTTGTATCATTTATTTCCCACTCAGATATTGCTAGCTGAGGGGAATAACTAGACAAGGTTTGACGGCCTAGAGGAA

Reverse complement sequence

TTCCTCTAGGCCGTCAAACCTTGTCTAGTTATTCCCCTCAGCTAGCAATATCTGAGTGGGAAATAAATGATACAACTGCCGTGTTTGCGTATTTGCGGTT[T/A]
TAATGTTCTACCATGTTGTTGCTTACATGTATGTATATAACTATTTTGACCACAGGGTTCCCAATGCAAAGCCTGAGAGGGAATCAACAGAGATTGAGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.20% 12.10% 8.68% 31.00% NA
All Indica  2759 15.40% 18.60% 14.17% 51.79% NA
All Japonica  1512 99.60% 0.00% 0.13% 0.26% NA
Aus  269 70.30% 20.10% 3.35% 6.32% NA
Indica I  595 5.50% 12.30% 10.08% 72.10% NA
Indica II  465 24.10% 5.60% 12.90% 57.42% NA
Indica III  913 13.50% 30.60% 14.02% 41.95% NA
Indica Intermediate  786 20.00% 17.30% 18.19% 44.53% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.60% 0.00% 0.20% 0.20% NA
Japonica Intermediate  241 98.80% 0.00% 0.41% 0.83% NA
VI/Aromatic  96 96.90% 1.00% 1.04% 1.04% NA
Intermediate  90 71.10% 5.60% 7.78% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922290793 A -> DEL N N silent_mutation Average:57.874; most accessible tissue: Callus, score: 75.681 N N N N
vg0922290793 A -> T LOC_Os09g38784.1 upstream_gene_variant ; 4265.0bp to feature; MODIFIER silent_mutation Average:57.874; most accessible tissue: Callus, score: 75.681 N N N N
vg0922290793 A -> T LOC_Os09g38800.1 upstream_gene_variant ; 1556.0bp to feature; MODIFIER silent_mutation Average:57.874; most accessible tissue: Callus, score: 75.681 N N N N
vg0922290793 A -> T LOC_Os09g38790.1 intron_variant ; MODIFIER silent_mutation Average:57.874; most accessible tissue: Callus, score: 75.681 N N N N
vg0922290793 A -> T LOC_Os09g38790.2 intron_variant ; MODIFIER silent_mutation Average:57.874; most accessible tissue: Callus, score: 75.681 N N N N
vg0922290793 A -> T LOC_Os09g38790.3 intron_variant ; MODIFIER silent_mutation Average:57.874; most accessible tissue: Callus, score: 75.681 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922290793 NA 2.27E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922290793 NA 7.43E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922290793 3.19E-06 NA mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922290793 4.63E-06 3.16E-45 mr1208_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922290793 NA 3.91E-06 mr1208_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922290793 NA 1.66E-24 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922290793 NA 2.07E-22 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922290793 NA 1.01E-19 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922290793 NA 9.44E-32 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922290793 NA 5.75E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922290793 7.18E-10 NA mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922290793 2.82E-09 3.40E-08 mr1865_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251