\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922282634:

Variant ID: vg0922282634 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22282634
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TATACATTTCAAGAAATTAGGCAGACCAATCCTGACTATGCTCAAGGTTACAAAGTTCTATTTTGACTTAAAAAGGATCTGCTTTGCTTATGAAATATAT[A/G]
TCTCTTTGTGATATTTTCAACAGCATCAGAAATTAGAGAGACCAATCCTGACTATGCTCAAGGTTACAAAGTTCTGTTTGCTGACGACTTCCCATTCCTG

Reverse complement sequence

CAGGAATGGGAAGTCGTCAGCAAACAGAACTTTGTAACCTTGAGCATAGTCAGGATTGGTCTCTCTAATTTCTGATGCTGTTGAAAATATCACAAAGAGA[T/C]
ATATATTTCATAAGCAAAGCAGATCCTTTTTAAGTCAAAATAGAACTTTGTAACCTTGAGCATAGTCAGGATTGGTCTGCCTAATTTCTTGAAATGTATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 43.80% 0.08% 0.21% NA
All Indica  2759 92.10% 7.40% 0.14% 0.36% NA
All Japonica  1512 0.40% 99.60% 0.00% 0.00% NA
Aus  269 24.90% 75.10% 0.00% 0.00% NA
Indica I  595 98.50% 1.20% 0.34% 0.00% NA
Indica II  465 84.50% 14.40% 0.43% 0.65% NA
Indica III  913 96.40% 3.10% 0.00% 0.55% NA
Indica Intermediate  786 86.60% 13.10% 0.00% 0.25% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 30.00% 70.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922282634 A -> G LOC_Os09g38768.1 downstream_gene_variant ; 4771.0bp to feature; MODIFIER silent_mutation Average:65.453; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0922282634 A -> G LOC_Os09g38772.1 downstream_gene_variant ; 1585.0bp to feature; MODIFIER silent_mutation Average:65.453; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0922282634 A -> G LOC_Os09g38784.1 downstream_gene_variant ; 1810.0bp to feature; MODIFIER silent_mutation Average:65.453; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0922282634 A -> G LOC_Os09g38790.1 downstream_gene_variant ; 4540.0bp to feature; MODIFIER silent_mutation Average:65.453; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0922282634 A -> G LOC_Os09g38768.2 downstream_gene_variant ; 4771.0bp to feature; MODIFIER silent_mutation Average:65.453; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0922282634 A -> G LOC_Os09g38790.2 downstream_gene_variant ; 4540.0bp to feature; MODIFIER silent_mutation Average:65.453; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0922282634 A -> G LOC_Os09g38790.3 downstream_gene_variant ; 4540.0bp to feature; MODIFIER silent_mutation Average:65.453; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0922282634 A -> G LOC_Os09g38777.1 intron_variant ; MODIFIER silent_mutation Average:65.453; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N
vg0922282634 A -> DEL N N silent_mutation Average:65.453; most accessible tissue: Zhenshan97 flower, score: 84.874 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922282634 2.37E-08 2.37E-08 mr1848_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922282634 6.15E-06 NA mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251