\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922275709:

Variant ID: vg0922275709 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22275709
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTCTTTCTGCTGCCACTTGAATTTTTATGGTAACCACAACCGCTTTGGTTCGAGAAGTATACTCCTTCACCTGCTTCGGATCTTTAACTGTTCTATCG[G/A]
GTGTTCATTTCAGCACTGTATAGTATATGCAGCAACACTTGCAATTATCTTTGTTTTGGAATGGCTTCCGGAGTTTGGGGATAAATTTATAGTACATGAA

Reverse complement sequence

TTCATGTACTATAAATTTATCCCCAAACTCCGGAAGCCATTCCAAAACAAAGATAATTGCAAGTGTTGCTGCATATACTATACAGTGCTGAAATGAACAC[C/T]
CGATAGAACAGTTAAAGATCCGAAGCAGGTGAAGGAGTATACTTCTCGAACCAAAGCGGTTGTGGTTACCATAAAAATTCAAGTGGCAGCAGAAAGAAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 8.00% 0.83% 0.00% NA
All Indica  2759 99.40% 0.50% 0.07% 0.00% NA
All Japonica  1512 80.40% 17.70% 1.98% 0.00% NA
Aus  269 70.30% 28.30% 1.49% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.70% 0.13% 0.00% NA
Temperate Japonica  767 97.30% 0.50% 2.22% 0.00% NA
Tropical Japonica  504 47.40% 50.60% 1.98% 0.00% NA
Japonica Intermediate  241 95.40% 3.30% 1.24% 0.00% NA
VI/Aromatic  96 94.80% 4.20% 1.04% 0.00% NA
Intermediate  90 78.90% 18.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922275709 G -> A LOC_Os09g38772.1 upstream_gene_variant ; 2583.0bp to feature; MODIFIER silent_mutation Average:70.658; most accessible tissue: Zhenshan97 flower, score: 84.018 N N N N
vg0922275709 G -> A LOC_Os09g38755.1 downstream_gene_variant ; 3029.0bp to feature; MODIFIER silent_mutation Average:70.658; most accessible tissue: Zhenshan97 flower, score: 84.018 N N N N
vg0922275709 G -> A LOC_Os09g38759.1 downstream_gene_variant ; 734.0bp to feature; MODIFIER silent_mutation Average:70.658; most accessible tissue: Zhenshan97 flower, score: 84.018 N N N N
vg0922275709 G -> A LOC_Os09g38768.1 intron_variant ; MODIFIER silent_mutation Average:70.658; most accessible tissue: Zhenshan97 flower, score: 84.018 N N N N
vg0922275709 G -> A LOC_Os09g38768.2 intron_variant ; MODIFIER silent_mutation Average:70.658; most accessible tissue: Zhenshan97 flower, score: 84.018 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922275709 NA 1.77E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 1.67E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 5.87E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 5.25E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 1.77E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 2.55E-10 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 7.89E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 3.33E-07 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 2.35E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 2.97E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 2.17E-07 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 3.87E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 3.30E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 2.46E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 4.98E-12 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 9.92E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 1.43E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 9.12E-07 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 1.53E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 2.80E-06 2.98E-12 mr1798_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 3.28E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 2.92E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709 NA 1.03E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251