Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922275709:

Variant ID: vg0922275709 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22275709
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:

GTTTCTTTCTGCTGCCACTTGAATTTTTATGGTAACCACAACCGCTTTGGTTCGAGAAGTATACTCCTTCACCTGCTTCGGATCTTTAACTGTTCTATCG[G/A]
GTGTTCATTTCAGCACTGTATAGTATATGCAGCAACACTTGCAATTATCTTTGTTTTGGAATGGCTTCCGGAGTTTGGGGATAAATTTATAGTACATGAA

Reverse complement sequence

TTCATGTACTATAAATTTATCCCCAAACTCCGGAAGCCATTCCAAAACAAAGATAATTGCAAGTGTTGCTGCATATACTATACAGTGCTGAAATGAACAC[C/T]
CGATAGAACAGTTAAAGATCCGAAGCAGGTGAAGGAGTATACTTCTCGAACCAAAGCGGTTGTGGTTACCATAAAAATTCAAGTGGCAGCAGAAAGAAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.20%	8.00%	0.83%	0.00%	NA
All Indica	2759	99.40%	0.50%	0.07%	0.00%	NA
All Japonica	1512	80.40%	17.70%	1.98%	0.00%	NA
Aus	269	70.30%	28.30%	1.49%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	1.70%	0.13%	0.00%	NA
Temperate Japonica	767	97.30%	0.50%	2.22%	0.00%	NA
Tropical Japonica	504	47.40%	50.60%	1.98%	0.00%	NA
Japonica Intermediate	241	95.40%	3.30%	1.24%	0.00%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	78.90%	18.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922275709	G -> A	LOC_Os09g38772.1	upstream_gene_variant ; 2583.0bp to feature; MODIFIER	silent_mutation	Average:70.658; most accessible tissue: Zhenshan97 flower, score: 84.018	N	N	N	N
vg0922275709	G -> A	LOC_Os09g38755.1	downstream_gene_variant ; 3029.0bp to feature; MODIFIER	silent_mutation	Average:70.658; most accessible tissue: Zhenshan97 flower, score: 84.018	N	N	N	N
vg0922275709	G -> A	LOC_Os09g38759.1	downstream_gene_variant ; 734.0bp to feature; MODIFIER	silent_mutation	Average:70.658; most accessible tissue: Zhenshan97 flower, score: 84.018	N	N	N	N
vg0922275709	G -> A	LOC_Os09g38768.1	intron_variant ; MODIFIER	silent_mutation	Average:70.658; most accessible tissue: Zhenshan97 flower, score: 84.018	N	N	N	N
vg0922275709	G -> A	LOC_Os09g38768.2	intron_variant ; MODIFIER	silent_mutation	Average:70.658; most accessible tissue: Zhenshan97 flower, score: 84.018	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922275709	NA	1.77E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	1.67E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	5.87E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	5.25E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	1.77E-06	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	2.55E-10	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	7.89E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	3.33E-07	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	2.35E-06	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	2.97E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	2.17E-07	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	3.87E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	3.30E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	2.46E-06	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	4.98E-12	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	9.92E-08	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	1.43E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	9.12E-07	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	1.53E-08	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	2.80E-06	2.98E-12	mr1798_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	3.28E-07	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	2.92E-06	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922275709	NA	1.03E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251