\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922253697:

Variant ID: vg0922253697 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22253697
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.26, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTGTCAAAATTTTGAAATCGTACACAGTAAGATTCAGAAAGCTAACCAAATCAGGAGGAAATGAACTTAGCCCAAATCAATCAAGGGAAACCAAATAA[T/C]
GCACCAAATTCGAGATGAATAGCTATTGCGGCAAGGCTTTCACGCATCAATCTCAAGCTTATACTTAATTAGACGCATCGCACTATGATCATTTGAACAG

Reverse complement sequence

CTGTTCAAATGATCATAGTGCGATGCGTCTAATTAAGTATAAGCTTGAGATTGATGCGTGAAAGCCTTGCCGCAATAGCTATTCATCTCGAATTTGGTGC[A/G]
TTATTTGGTTTCCCTTGATTGATTTGGGCTAAGTTCATTTCCTCCTGATTTGGTTAGCTTTCTGAATCTTACTGTGTACGATTTCAAAATTTTGACAGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 41.90% 0.04% 0.02% NA
All Indica  2759 95.00% 5.00% 0.04% 0.00% NA
All Japonica  1512 0.70% 99.30% 0.07% 0.00% NA
Aus  269 30.90% 69.10% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 88.60% 11.20% 0.22% 0.00% NA
Indica III  913 97.50% 2.50% 0.00% 0.00% NA
Indica Intermediate  786 92.60% 7.40% 0.00% 0.00% NA
Temperate Japonica  767 0.70% 99.20% 0.13% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 30.00% 68.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922253697 T -> DEL N N silent_mutation Average:66.858; most accessible tissue: Callus, score: 76.67 N N N N
vg0922253697 T -> C LOC_Os09g38720.1 upstream_gene_variant ; 2302.0bp to feature; MODIFIER silent_mutation Average:66.858; most accessible tissue: Callus, score: 76.67 N N N N
vg0922253697 T -> C LOC_Os09g38700.1 downstream_gene_variant ; 4395.0bp to feature; MODIFIER silent_mutation Average:66.858; most accessible tissue: Callus, score: 76.67 N N N N
vg0922253697 T -> C LOC_Os09g38710.1 intron_variant ; MODIFIER silent_mutation Average:66.858; most accessible tissue: Callus, score: 76.67 N N N N
vg0922253697 T -> C LOC_Os09g38710.2 intron_variant ; MODIFIER silent_mutation Average:66.858; most accessible tissue: Callus, score: 76.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922253697 NA 6.89E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697 NA 3.76E-39 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697 NA 7.35E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697 8.15E-08 NA mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697 4.03E-07 NA mr1865 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697 NA 2.13E-43 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697 NA 8.17E-25 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697 NA 1.92E-32 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697 2.24E-11 NA mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922253697 1.18E-11 2.61E-09 mr1865_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251