\
| Variant ID: vg0922253697 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22253697 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.26, others allele: 0.00, population size: 55. )
AGCTGTCAAAATTTTGAAATCGTACACAGTAAGATTCAGAAAGCTAACCAAATCAGGAGGAAATGAACTTAGCCCAAATCAATCAAGGGAAACCAAATAA[T/C]
GCACCAAATTCGAGATGAATAGCTATTGCGGCAAGGCTTTCACGCATCAATCTCAAGCTTATACTTAATTAGACGCATCGCACTATGATCATTTGAACAG
CTGTTCAAATGATCATAGTGCGATGCGTCTAATTAAGTATAAGCTTGAGATTGATGCGTGAAAGCCTTGCCGCAATAGCTATTCATCTCGAATTTGGTGC[A/G]
TTATTTGGTTTCCCTTGATTGATTTGGGCTAAGTTCATTTCCTCCTGATTTGGTTAGCTTTCTGAATCTTACTGTGTACGATTTCAAAATTTTGACAGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.10% | 41.90% | 0.04% | 0.02% | NA |
| All Indica | 2759 | 95.00% | 5.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 0.70% | 99.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 30.90% | 69.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.60% | 11.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.70% | 99.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 30.00% | 68.90% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922253697 | T -> DEL | N | N | silent_mutation | Average:66.858; most accessible tissue: Callus, score: 76.67 | N | N | N | N |
| vg0922253697 | T -> C | LOC_Os09g38720.1 | upstream_gene_variant ; 2302.0bp to feature; MODIFIER | silent_mutation | Average:66.858; most accessible tissue: Callus, score: 76.67 | N | N | N | N |
| vg0922253697 | T -> C | LOC_Os09g38700.1 | downstream_gene_variant ; 4395.0bp to feature; MODIFIER | silent_mutation | Average:66.858; most accessible tissue: Callus, score: 76.67 | N | N | N | N |
| vg0922253697 | T -> C | LOC_Os09g38710.1 | intron_variant ; MODIFIER | silent_mutation | Average:66.858; most accessible tissue: Callus, score: 76.67 | N | N | N | N |
| vg0922253697 | T -> C | LOC_Os09g38710.2 | intron_variant ; MODIFIER | silent_mutation | Average:66.858; most accessible tissue: Callus, score: 76.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922253697 | NA | 6.89E-13 | mr1655 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922253697 | NA | 3.76E-39 | mr1721 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922253697 | NA | 7.35E-08 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922253697 | 8.15E-08 | NA | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922253697 | 4.03E-07 | NA | mr1865 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922253697 | NA | 2.13E-43 | mr1208_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922253697 | NA | 8.17E-25 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922253697 | NA | 1.92E-32 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922253697 | 2.24E-11 | NA | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922253697 | 1.18E-11 | 2.61E-09 | mr1865_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |