\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922222774:

Variant ID: vg0922222774 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22222774
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TAATACCTAGAGAATTTCGTGCTATAATCTTTATAATTTTGAAAACATTATTTCACTTGATCATTTTATTGGCAGAAGTTAGGGTTTATCCAATCACTTC[T/C]
TTTTTTTAATTCCTTCTTTTTCATTTATGGGACTTGTTGGCTGTGTGCACATGGCCACTTGGGTATAAGGAGCATATTGATCCATGTATTTTTGAAAGAA

Reverse complement sequence

TTCTTTCAAAAATACATGGATCAATATGCTCCTTATACCCAAGTGGCCATGTGCACACAGCCAACAAGTCCCATAAATGAAAAAGAAGGAATTAAAAAAA[A/G]
GAAGTGATTGGATAAACCCTAACTTCTGCCAATAAAATGATCAAGTGAAATAATGTTTTCAAAATTATAAAGATTATAGCACGAAATTCTCTAGGTATTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 45.70% 1.63% 1.84% NA
All Indica  2759 19.40% 74.80% 2.68% 3.15% NA
All Japonica  1512 99.50% 0.50% 0.07% 0.00% NA
Aus  269 73.20% 26.80% 0.00% 0.00% NA
Indica I  595 20.80% 61.70% 8.40% 9.08% NA
Indica II  465 17.00% 80.60% 0.43% 1.94% NA
Indica III  913 15.60% 84.30% 0.11% 0.00% NA
Indica Intermediate  786 24.20% 70.10% 2.67% 3.05% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 18.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922222774 T -> DEL N N silent_mutation Average:43.837; most accessible tissue: Callus, score: 87.588 N N N N
vg0922222774 T -> C LOC_Os09g38620.1 upstream_gene_variant ; 4522.0bp to feature; MODIFIER silent_mutation Average:43.837; most accessible tissue: Callus, score: 87.588 N N N N
vg0922222774 T -> C LOC_Os09g38630.1 upstream_gene_variant ; 787.0bp to feature; MODIFIER silent_mutation Average:43.837; most accessible tissue: Callus, score: 87.588 N N N N
vg0922222774 T -> C LOC_Os09g38640.1 downstream_gene_variant ; 266.0bp to feature; MODIFIER silent_mutation Average:43.837; most accessible tissue: Callus, score: 87.588 N N N N
vg0922222774 T -> C LOC_Os09g38650.1 downstream_gene_variant ; 2453.0bp to feature; MODIFIER silent_mutation Average:43.837; most accessible tissue: Callus, score: 87.588 N N N N
vg0922222774 T -> C LOC_Os09g38630-LOC_Os09g38640 intergenic_region ; MODIFIER silent_mutation Average:43.837; most accessible tissue: Callus, score: 87.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922222774 NA 9.49E-14 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 1.15E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 8.63E-07 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 3.05E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 1.06E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 9.68E-09 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 7.22E-08 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 4.75E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 2.42E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 3.19E-08 mr1706 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 7.68E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 3.36E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 7.67E-07 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 2.17E-06 mr1759 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 3.22E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 2.79E-06 mr1763 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 4.54E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 2.66E-24 2.02E-72 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 1.71E-25 1.07E-25 mr1865 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 9.13E-06 9.13E-06 mr1890 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 4.73E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 6.28E-06 mr1520_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 NA 1.34E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 1.11E-17 NA mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774 3.04E-17 4.13E-21 mr1865_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251