Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922222774:

Variant ID: vg0922222774 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22222774
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

TAATACCTAGAGAATTTCGTGCTATAATCTTTATAATTTTGAAAACATTATTTCACTTGATCATTTTATTGGCAGAAGTTAGGGTTTATCCAATCACTTC[T/C]
TTTTTTTAATTCCTTCTTTTTCATTTATGGGACTTGTTGGCTGTGTGCACATGGCCACTTGGGTATAAGGAGCATATTGATCCATGTATTTTTGAAAGAA

Reverse complement sequence

TTCTTTCAAAAATACATGGATCAATATGCTCCTTATACCCAAGTGGCCATGTGCACACAGCCAACAAGTCCCATAAATGAAAAAGAAGGAATTAAAAAAA[A/G]
GAAGTGATTGGATAAACCCTAACTTCTGCCAATAAAATGATCAAGTGAAATAATGTTTTCAAAATTATAAAGATTATAGCACGAAATTCTCTAGGTATTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.80%	45.70%	1.63%	1.84%	NA
All Indica	2759	19.40%	74.80%	2.68%	3.15%	NA
All Japonica	1512	99.50%	0.50%	0.07%	0.00%	NA
Aus	269	73.20%	26.80%	0.00%	0.00%	NA
Indica I	595	20.80%	61.70%	8.40%	9.08%	NA
Indica II	465	17.00%	80.60%	0.43%	1.94%	NA
Indica III	913	15.60%	84.30%	0.11%	0.00%	NA
Indica Intermediate	786	24.20%	70.10%	2.67%	3.05%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	0.80%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	18.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922222774	T -> DEL	N	N	silent_mutation	Average:43.837; most accessible tissue: Callus, score: 87.588	N	N	N	N
vg0922222774	T -> C	LOC_Os09g38620.1	upstream_gene_variant ; 4522.0bp to feature; MODIFIER	silent_mutation	Average:43.837; most accessible tissue: Callus, score: 87.588	N	N	N	N
vg0922222774	T -> C	LOC_Os09g38630.1	upstream_gene_variant ; 787.0bp to feature; MODIFIER	silent_mutation	Average:43.837; most accessible tissue: Callus, score: 87.588	N	N	N	N
vg0922222774	T -> C	LOC_Os09g38640.1	downstream_gene_variant ; 266.0bp to feature; MODIFIER	silent_mutation	Average:43.837; most accessible tissue: Callus, score: 87.588	N	N	N	N
vg0922222774	T -> C	LOC_Os09g38650.1	downstream_gene_variant ; 2453.0bp to feature; MODIFIER	silent_mutation	Average:43.837; most accessible tissue: Callus, score: 87.588	N	N	N	N
vg0922222774	T -> C	LOC_Os09g38630-LOC_Os09g38640	intergenic_region ; MODIFIER	silent_mutation	Average:43.837; most accessible tissue: Callus, score: 87.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922222774	NA	9.49E-14	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	1.15E-10	mr1195	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	8.63E-07	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	3.05E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	1.06E-09	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	9.68E-09	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	7.22E-08	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	4.75E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	2.42E-09	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	3.19E-08	mr1706	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	7.68E-08	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	3.36E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	7.67E-07	mr1759	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	2.17E-06	mr1759	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	3.22E-08	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	2.79E-06	mr1763	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	4.54E-08	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	2.66E-24	2.02E-72	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	1.71E-25	1.07E-25	mr1865	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	9.13E-06	9.13E-06	mr1890	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	4.73E-06	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	6.28E-06	mr1520_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	NA	1.34E-06	mr1629_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	1.11E-17	NA	mr1865_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922222774	3.04E-17	4.13E-21	mr1865_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251