Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922210878:

Variant ID: vg0922210878 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22210878
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGCTCCGATCCCAAACGATGCTAGAATGGCAGGTTATGTTGTCCCATGATTTTCACATCGACAATCTTGGGGAGCTTATAGAAAGTATCCACGTACAT[A/G]
TAGTGTCAAGAAAGAAATTAATGTTTTATAGAACCATTCATATAGACAGTGCATCCACGTACATATATAAATGTATTATCCATAAATTAAATTAGTTGCT

Reverse complement sequence

AGCAACTAATTTAATTTATGGATAATACATTTATATATGTACGTGGATGCACTGTCTATATGAATGGTTCTATAAAACATTAATTTCTTTCTTGACACTA[T/C]
ATGTACGTGGATACTTTCTATAAGCTCCCCAAGATTGTCGATGTGAAAATCATGGGACAACATAACCTGCCATTCTAGCATCGTTTGGGATCGGAGCTAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.00%	8.00%	0.02%	0.00%	NA
All Indica	2759	86.60%	13.40%	0.04%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	65.00%	35.00%	0.00%	0.00%	NA
Indica II	465	95.90%	4.10%	0.00%	0.00%	NA
Indica III	913	97.20%	2.80%	0.00%	0.00%	NA
Indica Intermediate	786	85.10%	14.80%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922210878	A -> G	LOC_Os09g38610.1	upstream_gene_variant ; 2376.0bp to feature; MODIFIER	silent_mutation	Average:48.989; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N
vg0922210878	A -> G	LOC_Os09g38620.1	downstream_gene_variant ; 1512.0bp to feature; MODIFIER	silent_mutation	Average:48.989; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N
vg0922210878	A -> G	LOC_Os09g38610-LOC_Os09g38620	intergenic_region ; MODIFIER	silent_mutation	Average:48.989; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922210878	NA	3.71E-06	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878	NA	3.60E-06	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878	1.17E-10	NA	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878	2.75E-11	7.50E-13	mr1865	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878	NA	3.19E-06	mr1331_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878	NA	9.35E-06	mr1331_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878	NA	4.72E-06	mr1629_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878	7.58E-10	NA	mr1865_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878	2.85E-10	3.78E-12	mr1865_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878	NA	4.78E-09	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251