\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922210878:

Variant ID: vg0922210878 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22210878
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGCTCCGATCCCAAACGATGCTAGAATGGCAGGTTATGTTGTCCCATGATTTTCACATCGACAATCTTGGGGAGCTTATAGAAAGTATCCACGTACAT[A/G]
TAGTGTCAAGAAAGAAATTAATGTTTTATAGAACCATTCATATAGACAGTGCATCCACGTACATATATAAATGTATTATCCATAAATTAAATTAGTTGCT

Reverse complement sequence

AGCAACTAATTTAATTTATGGATAATACATTTATATATGTACGTGGATGCACTGTCTATATGAATGGTTCTATAAAACATTAATTTCTTTCTTGACACTA[T/C]
ATGTACGTGGATACTTTCTATAAGCTCCCCAAGATTGTCGATGTGAAAATCATGGGACAACATAACCTGCCATTCTAGCATCGTTTGGGATCGGAGCTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 8.00% 0.02% 0.00% NA
All Indica  2759 86.60% 13.40% 0.04% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 65.00% 35.00% 0.00% 0.00% NA
Indica II  465 95.90% 4.10% 0.00% 0.00% NA
Indica III  913 97.20% 2.80% 0.00% 0.00% NA
Indica Intermediate  786 85.10% 14.80% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922210878 A -> G LOC_Os09g38610.1 upstream_gene_variant ; 2376.0bp to feature; MODIFIER silent_mutation Average:48.989; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0922210878 A -> G LOC_Os09g38620.1 downstream_gene_variant ; 1512.0bp to feature; MODIFIER silent_mutation Average:48.989; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0922210878 A -> G LOC_Os09g38610-LOC_Os09g38620 intergenic_region ; MODIFIER silent_mutation Average:48.989; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922210878 NA 3.71E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878 NA 3.60E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878 1.17E-10 NA mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878 2.75E-11 7.50E-13 mr1865 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878 NA 3.19E-06 mr1331_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878 NA 9.35E-06 mr1331_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878 NA 4.72E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878 7.58E-10 NA mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878 2.85E-10 3.78E-12 mr1865_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922210878 NA 4.78E-09 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251