Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922205633:

Variant ID: vg0922205633 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22205633
Reference Allele: T	Alternative Allele: C,G
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.18, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

TTCAGCAGCCTGTCTGATGCTGCAGCTACTACGAAAGGGGCGATTTCGCATGCTTAATCACTGCTAGAGGTGCTCAAGTGAACTGGGGCTGTGTTTAGAT[T/C,G]
CAAAGTTTGGATCCAAATTTCAGTTCTTTTCCATCACATCAACCTGTTATACACACACACACAACTTTTCAATCACATCATTTTTCATTTCAACCAAAAT

Reverse complement sequence

ATTTTGGTTGAAATGAAAAATGATGTGATTGAAAAGTTGTGTGTGTGTGTATAACAGGTTGATGTGATGGAAAAGAACTGAAATTTGGATCCAAACTTTG[A/G,C]
ATCTAAACACAGCCCCAGTTCACTTGAGCACCTCTAGCAGTGATTAAGCATGCGAAATCGCCCCTTTCGTAGTAGCTGCAGCATCAGACAGGCTGCTGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.30%	41.00%	0.68%	0.02%	G: 0.02%
All Indica	2759	36.50%	62.70%	0.76%	0.04%	G: 0.04%
All Japonica	1512	99.50%	0.50%	0.07%	0.00%	NA
Aus	269	33.10%	64.30%	2.60%	0.00%	NA
Indica I	595	39.30%	60.30%	0.34%	0.00%	NA
Indica II	465	33.80%	64.70%	1.51%	0.00%	NA
Indica III	913	31.20%	68.30%	0.33%	0.00%	G: 0.11%
Indica Intermediate	786	42.00%	56.70%	1.15%	0.13%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	73.30%	24.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922205633	T -> G	LOC_Os09g38600.1	downstream_gene_variant ; 1465.0bp to feature; MODIFIER	silent_mutation	Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0922205633	T -> G	LOC_Os09g38610.1	downstream_gene_variant ; 2010.0bp to feature; MODIFIER	silent_mutation	Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0922205633	T -> G	LOC_Os09g38600-LOC_Os09g38610	intergenic_region ; MODIFIER	silent_mutation	Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0922205633	T -> DEL	N	N	silent_mutation	Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0922205633	T -> C	LOC_Os09g38600.1	downstream_gene_variant ; 1465.0bp to feature; MODIFIER	silent_mutation	Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0922205633	T -> C	LOC_Os09g38610.1	downstream_gene_variant ; 2010.0bp to feature; MODIFIER	silent_mutation	Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0922205633	T -> C	LOC_Os09g38600-LOC_Os09g38610	intergenic_region ; MODIFIER	silent_mutation	Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922205633	NA	1.25E-07	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922205633	NA	9.03E-07	mr1438	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922205633	1.61E-06	NA	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922205633	1.18E-06	8.18E-06	mr1263_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922205633	2.97E-06	NA	mr1835_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251