\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922205633:

Variant ID: vg0922205633 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22205633
Reference Allele: TAlternative Allele: C,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.18, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAGCAGCCTGTCTGATGCTGCAGCTACTACGAAAGGGGCGATTTCGCATGCTTAATCACTGCTAGAGGTGCTCAAGTGAACTGGGGCTGTGTTTAGAT[T/C,G]
CAAAGTTTGGATCCAAATTTCAGTTCTTTTCCATCACATCAACCTGTTATACACACACACACAACTTTTCAATCACATCATTTTTCATTTCAACCAAAAT

Reverse complement sequence

ATTTTGGTTGAAATGAAAAATGATGTGATTGAAAAGTTGTGTGTGTGTGTATAACAGGTTGATGTGATGGAAAAGAACTGAAATTTGGATCCAAACTTTG[A/G,C]
ATCTAAACACAGCCCCAGTTCACTTGAGCACCTCTAGCAGTGATTAAGCATGCGAAATCGCCCCTTTCGTAGTAGCTGCAGCATCAGACAGGCTGCTGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 41.00% 0.68% 0.02% G: 0.02%
All Indica  2759 36.50% 62.70% 0.76% 0.04% G: 0.04%
All Japonica  1512 99.50% 0.50% 0.07% 0.00% NA
Aus  269 33.10% 64.30% 2.60% 0.00% NA
Indica I  595 39.30% 60.30% 0.34% 0.00% NA
Indica II  465 33.80% 64.70% 1.51% 0.00% NA
Indica III  913 31.20% 68.30% 0.33% 0.00% G: 0.11%
Indica Intermediate  786 42.00% 56.70% 1.15% 0.13% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 94.80% 4.20% 1.04% 0.00% NA
Intermediate  90 73.30% 24.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922205633 T -> G LOC_Os09g38600.1 downstream_gene_variant ; 1465.0bp to feature; MODIFIER silent_mutation Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0922205633 T -> G LOC_Os09g38610.1 downstream_gene_variant ; 2010.0bp to feature; MODIFIER silent_mutation Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0922205633 T -> G LOC_Os09g38600-LOC_Os09g38610 intergenic_region ; MODIFIER silent_mutation Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0922205633 T -> DEL N N silent_mutation Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0922205633 T -> C LOC_Os09g38600.1 downstream_gene_variant ; 1465.0bp to feature; MODIFIER silent_mutation Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0922205633 T -> C LOC_Os09g38610.1 downstream_gene_variant ; 2010.0bp to feature; MODIFIER silent_mutation Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0922205633 T -> C LOC_Os09g38600-LOC_Os09g38610 intergenic_region ; MODIFIER silent_mutation Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922205633 NA 1.25E-07 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922205633 NA 9.03E-07 mr1438 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922205633 1.61E-06 NA mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922205633 1.18E-06 8.18E-06 mr1263_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922205633 2.97E-06 NA mr1835_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251