\
| Variant ID: vg0922205633 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22205633 |
| Reference Allele: T | Alternative Allele: C,G |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.18, others allele: 0.00, population size: 73. )
TTCAGCAGCCTGTCTGATGCTGCAGCTACTACGAAAGGGGCGATTTCGCATGCTTAATCACTGCTAGAGGTGCTCAAGTGAACTGGGGCTGTGTTTAGAT[T/C,G]
CAAAGTTTGGATCCAAATTTCAGTTCTTTTCCATCACATCAACCTGTTATACACACACACACAACTTTTCAATCACATCATTTTTCATTTCAACCAAAAT
ATTTTGGTTGAAATGAAAAATGATGTGATTGAAAAGTTGTGTGTGTGTGTATAACAGGTTGATGTGATGGAAAAGAACTGAAATTTGGATCCAAACTTTG[A/G,C]
ATCTAAACACAGCCCCAGTTCACTTGAGCACCTCTAGCAGTGATTAAGCATGCGAAATCGCCCCTTTCGTAGTAGCTGCAGCATCAGACAGGCTGCTGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.30% | 41.00% | 0.68% | 0.02% | G: 0.02% |
| All Indica | 2759 | 36.50% | 62.70% | 0.76% | 0.04% | G: 0.04% |
| All Japonica | 1512 | 99.50% | 0.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 33.10% | 64.30% | 2.60% | 0.00% | NA |
| Indica I | 595 | 39.30% | 60.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 33.80% | 64.70% | 1.51% | 0.00% | NA |
| Indica III | 913 | 31.20% | 68.30% | 0.33% | 0.00% | G: 0.11% |
| Indica Intermediate | 786 | 42.00% | 56.70% | 1.15% | 0.13% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 4.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 24.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922205633 | T -> G | LOC_Os09g38600.1 | downstream_gene_variant ; 1465.0bp to feature; MODIFIER | silent_mutation | Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0922205633 | T -> G | LOC_Os09g38610.1 | downstream_gene_variant ; 2010.0bp to feature; MODIFIER | silent_mutation | Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0922205633 | T -> G | LOC_Os09g38600-LOC_Os09g38610 | intergenic_region ; MODIFIER | silent_mutation | Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0922205633 | T -> DEL | N | N | silent_mutation | Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0922205633 | T -> C | LOC_Os09g38600.1 | downstream_gene_variant ; 1465.0bp to feature; MODIFIER | silent_mutation | Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0922205633 | T -> C | LOC_Os09g38610.1 | downstream_gene_variant ; 2010.0bp to feature; MODIFIER | silent_mutation | Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0922205633 | T -> C | LOC_Os09g38600-LOC_Os09g38610 | intergenic_region ; MODIFIER | silent_mutation | Average:65.979; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922205633 | NA | 1.25E-07 | mr1320 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922205633 | NA | 9.03E-07 | mr1438 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922205633 | 1.61E-06 | NA | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922205633 | 1.18E-06 | 8.18E-06 | mr1263_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922205633 | 2.97E-06 | NA | mr1835_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |