\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922202326:

Variant ID: vg0922202326 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 22202326
Reference Allele: CAAlternative Allele: GA,C
Primary Allele: CASecondary Allele: GA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCACCGCCACCGCCATGCTCAGCAACGGCGGCCACCAAATCCAGGTCACCATCTGCGTCGCGCCGCCGCCGCTCGTCTCCTACATCTGCGCCTGGTCCCC[CA/GA,C]
CCACCCACCCCGCCGAGCTCTTCGACACGGAGCCCACCGTCGAGGCCGTCGACGCCGACCTCCTCCTCCTCCGCATCCACGTCTCGCTCAACCATGTCCA

Reverse complement sequence

TGGACATGGTTGAGCGAGACGTGGATGCGGAGGAGGAGGAGGTCGGCGTCGACGGCCTCGACGGTGGGCTCCGTGTCGAAGAGCTCGGCGGGGTGGGTGG[TG/TC,G]
GGGGACCAGGCGCAGATGTAGGAGACGAGCGGCGGCGGCGCGACGCAGATGGTGACCTGGATTTGGTGGCCGCCGTTGCTGAGCATGGCGGTGGCGGTGG

Allele Frequencies:

Populations Population SizeFrequency of CA(primary allele) Frequency of GA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 14.30% 10.90% 11.98% C: 0.08%
All Indica  2759 39.50% 23.20% 17.80% 19.28% C: 0.14%
All Japonica  1512 99.70% 0.10% 0.07% 0.13% NA
Aus  269 72.50% 11.50% 6.32% 9.67% NA
Indica I  595 38.30% 22.50% 23.87% 15.29% NA
Indica II  465 38.90% 22.40% 18.71% 19.78% C: 0.22%
Indica III  913 37.20% 26.80% 12.27% 23.44% C: 0.22%
Indica Intermediate  786 43.50% 20.10% 19.08% 17.18% C: 0.13%
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 84.40% 3.30% 5.56% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922202326 CA -> DEL LOC_Os09g38600.1 N frameshift_variant Average:87.187; most accessible tissue: Zhenshan97 young leaf, score: 93.461 N N N N
vg0922202326 CA -> GA LOC_Os09g38600.1 synonymous_variant ; p.Pro83Pro; LOW synonymous_codon Average:87.187; most accessible tissue: Zhenshan97 young leaf, score: 93.461 N N N N
vg0922202326 CA -> C LOC_Os09g38600.1 frameshift_variant ; p.Thr84fs; HIGH frameshift_variant Average:87.187; most accessible tissue: Zhenshan97 young leaf, score: 93.461 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0922202326 CA C 0.03 0.02 0.08 0.07 0.1 0.12
vg0922202326 CA GA -0.04 -0.04 -0.05 -0.05 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922202326 NA 2.13E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922202326 4.29E-06 NA mr1865 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922202326 1.73E-06 7.35E-07 mr1865 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922202326 NA 1.57E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922202326 1.10E-08 NA mr1865_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922202326 4.19E-09 7.25E-09 mr1865_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251