\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922141578:

Variant ID: vg0922141578 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22141578
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.36, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCTTTTGGGGAAACCTTGTGATGAATATGATAGTAAACCTAATTCAAAGTAGTGATAGGGGAAACTATTTTGATCCCTCGAGGGGATATCAATATCTT[T/C]
GTCGTTTGCATGTTACTCAAATGGTTATTAAAAAATGTGAAAAAATTTGAGAAGATGTATTAACGTGTGATATATCACGCCACAAACATTCAAGTTAAAA

Reverse complement sequence

TTTTAACTTGAATGTTTGTGGCGTGATATATCACACGTTAATACATCTTCTCAAATTTTTTCACATTTTTTAATAACCATTTGAGTAACATGCAAACGAC[A/G]
AAGATATTGATATCCCCTCGAGGGATCAAAATAGTTTCCCCTATCACTACTTTGAATTAGGTTTACTATCATATTCATCACAAGGTTTCCCCAAAAGAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.00% 21.90% 1.52% 38.55% NA
All Indica  2759 2.80% 32.60% 1.99% 62.63% NA
All Japonica  1512 99.50% 0.30% 0.00% 0.20% NA
Aus  269 23.00% 43.90% 5.58% 27.51% NA
Indica I  595 1.20% 41.80% 2.18% 54.79% NA
Indica II  465 4.90% 20.20% 1.51% 73.33% NA
Indica III  913 1.40% 33.80% 1.64% 63.09% NA
Indica Intermediate  786 4.20% 31.60% 2.54% 61.70% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 94.80% 2.10% 0.00% 3.12% NA
Intermediate  90 70.00% 12.20% 2.22% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922141578 T -> DEL N N silent_mutation Average:11.288; most accessible tissue: Callus, score: 61.08 N N N N
vg0922141578 T -> C LOC_Os09g38450.1 upstream_gene_variant ; 4537.0bp to feature; MODIFIER silent_mutation Average:11.288; most accessible tissue: Callus, score: 61.08 N N N N
vg0922141578 T -> C LOC_Os09g38480.1 upstream_gene_variant ; 4126.0bp to feature; MODIFIER silent_mutation Average:11.288; most accessible tissue: Callus, score: 61.08 N N N N
vg0922141578 T -> C LOC_Os09g38460.1 downstream_gene_variant ; 1983.0bp to feature; MODIFIER silent_mutation Average:11.288; most accessible tissue: Callus, score: 61.08 N N N N
vg0922141578 T -> C LOC_Os09g38470.1 intron_variant ; MODIFIER silent_mutation Average:11.288; most accessible tissue: Callus, score: 61.08 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922141578 NA 2.59E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922141578 NA 7.14E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922141578 2.05E-07 2.18E-73 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922141578 NA 5.16E-17 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922141578 3.37E-07 1.64E-38 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922141578 3.36E-06 2.22E-24 mr1362_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922141578 NA 1.77E-17 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922141578 2.18E-06 NA mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251