Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0922141578:

Variant ID: vg0922141578 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22141578
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.36, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCTTTTGGGGAAACCTTGTGATGAATATGATAGTAAACCTAATTCAAAGTAGTGATAGGGGAAACTATTTTGATCCCTCGAGGGGATATCAATATCTT[T/C]
GTCGTTTGCATGTTACTCAAATGGTTATTAAAAAATGTGAAAAAATTTGAGAAGATGTATTAACGTGTGATATATCACGCCACAAACATTCAAGTTAAAA

Reverse complement sequence

TTTTAACTTGAATGTTTGTGGCGTGATATATCACACGTTAATACATCTTCTCAAATTTTTTCACATTTTTTAATAACCATTTGAGTAACATGCAAACGAC[A/G]
AAGATATTGATATCCCCTCGAGGGATCAAAATAGTTTCCCCTATCACTACTTTGAATTAGGTTTACTATCATATTCATCACAAGGTTTCCCCAAAAGAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.00%	21.90%	1.52%	38.55%	NA
All Indica	2759	2.80%	32.60%	1.99%	62.63%	NA
All Japonica	1512	99.50%	0.30%	0.00%	0.20%	NA
Aus	269	23.00%	43.90%	5.58%	27.51%	NA
Indica I	595	1.20%	41.80%	2.18%	54.79%	NA
Indica II	465	4.90%	20.20%	1.51%	73.33%	NA
Indica III	913	1.40%	33.80%	1.64%	63.09%	NA
Indica Intermediate	786	4.20%	31.60%	2.54%	61.70%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.00%	0.41%	NA
VI/Aromatic	96	94.80%	2.10%	0.00%	3.12%	NA
Intermediate	90	70.00%	12.20%	2.22%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922141578	T -> DEL	N	N	silent_mutation	Average:11.288; most accessible tissue: Callus, score: 61.08	N	N	N	N
vg0922141578	T -> C	LOC_Os09g38450.1	upstream_gene_variant ; 4537.0bp to feature; MODIFIER	silent_mutation	Average:11.288; most accessible tissue: Callus, score: 61.08	N	N	N	N
vg0922141578	T -> C	LOC_Os09g38480.1	upstream_gene_variant ; 4126.0bp to feature; MODIFIER	silent_mutation	Average:11.288; most accessible tissue: Callus, score: 61.08	N	N	N	N
vg0922141578	T -> C	LOC_Os09g38460.1	downstream_gene_variant ; 1983.0bp to feature; MODIFIER	silent_mutation	Average:11.288; most accessible tissue: Callus, score: 61.08	N	N	N	N
vg0922141578	T -> C	LOC_Os09g38470.1	intron_variant ; MODIFIER	silent_mutation	Average:11.288; most accessible tissue: Callus, score: 61.08	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922141578	NA	2.59E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922141578	NA	7.14E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922141578	2.05E-07	2.18E-73	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922141578	NA	5.16E-17	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922141578	3.37E-07	1.64E-38	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922141578	3.36E-06	2.22E-24	mr1362_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922141578	NA	1.77E-17	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922141578	2.18E-06	NA	mr1865_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251