| Variant ID: vg0922141578 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22141578 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.36, others allele: 0.00, population size: 99. )
TTTCTTTTGGGGAAACCTTGTGATGAATATGATAGTAAACCTAATTCAAAGTAGTGATAGGGGAAACTATTTTGATCCCTCGAGGGGATATCAATATCTT[T/C]
GTCGTTTGCATGTTACTCAAATGGTTATTAAAAAATGTGAAAAAATTTGAGAAGATGTATTAACGTGTGATATATCACGCCACAAACATTCAAGTTAAAA
TTTTAACTTGAATGTTTGTGGCGTGATATATCACACGTTAATACATCTTCTCAAATTTTTTCACATTTTTTAATAACCATTTGAGTAACATGCAAACGAC[A/G]
AAGATATTGATATCCCCTCGAGGGATCAAAATAGTTTCCCCTATCACTACTTTGAATTAGGTTTACTATCATATTCATCACAAGGTTTCCCCAAAAGAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.00% | 21.90% | 1.52% | 38.55% | NA |
| All Indica | 2759 | 2.80% | 32.60% | 1.99% | 62.63% | NA |
| All Japonica | 1512 | 99.50% | 0.30% | 0.00% | 0.20% | NA |
| Aus | 269 | 23.00% | 43.90% | 5.58% | 27.51% | NA |
| Indica I | 595 | 1.20% | 41.80% | 2.18% | 54.79% | NA |
| Indica II | 465 | 4.90% | 20.20% | 1.51% | 73.33% | NA |
| Indica III | 913 | 1.40% | 33.80% | 1.64% | 63.09% | NA |
| Indica Intermediate | 786 | 4.20% | 31.60% | 2.54% | 61.70% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 94.80% | 2.10% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 70.00% | 12.20% | 2.22% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922141578 | T -> DEL | N | N | silent_mutation | Average:11.288; most accessible tissue: Callus, score: 61.08 | N | N | N | N |
| vg0922141578 | T -> C | LOC_Os09g38450.1 | upstream_gene_variant ; 4537.0bp to feature; MODIFIER | silent_mutation | Average:11.288; most accessible tissue: Callus, score: 61.08 | N | N | N | N |
| vg0922141578 | T -> C | LOC_Os09g38480.1 | upstream_gene_variant ; 4126.0bp to feature; MODIFIER | silent_mutation | Average:11.288; most accessible tissue: Callus, score: 61.08 | N | N | N | N |
| vg0922141578 | T -> C | LOC_Os09g38460.1 | downstream_gene_variant ; 1983.0bp to feature; MODIFIER | silent_mutation | Average:11.288; most accessible tissue: Callus, score: 61.08 | N | N | N | N |
| vg0922141578 | T -> C | LOC_Os09g38470.1 | intron_variant ; MODIFIER | silent_mutation | Average:11.288; most accessible tissue: Callus, score: 61.08 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922141578 | NA | 2.59E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922141578 | NA | 7.14E-11 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922141578 | 2.05E-07 | 2.18E-73 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922141578 | NA | 5.16E-17 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922141578 | 3.37E-07 | 1.64E-38 | mr1208_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922141578 | 3.36E-06 | 2.22E-24 | mr1362_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922141578 | NA | 1.77E-17 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922141578 | 2.18E-06 | NA | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |