| Variant ID: vg0922095856 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22095856 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.02, others allele: 0.00, population size: 117. )
AATGGAGATGTGCCAGTTTAAGATGCACTTTGTTTAACAATGTATGACGAGAAAAAAACATCGAAATAAAATGATATCTCGAATCTGTAAGTTAAGCCAC[C/A]
AGATATATTACTCAAATATAATATAAGATAAAAAGAAAATTTAACGACACAAAAAAGGTTCATACAAACTATGGAACTATACAAACGTGCCATCTAGATG
CATCTAGATGGCACGTTTGTATAGTTCCATAGTTTGTATGAACCTTTTTTGTGTCGTTAAATTTTCTTTTTATCTTATATTATATTTGAGTAATATATCT[G/T]
GTGGCTTAACTTACAGATTCGAGATATCATTTTATTTCGATGTTTTTTTCTCGTCATACATTGTTAAACAAAGTGCATCTTAAACTGGCACATCTCCATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.60% | 43.50% | 0.74% | 1.12% | NA |
| All Indica | 2759 | 29.60% | 67.60% | 1.05% | 1.78% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 39.00% | 59.90% | 0.74% | 0.37% | NA |
| Indica I | 595 | 32.90% | 66.10% | 1.01% | 0.00% | NA |
| Indica II | 465 | 17.00% | 74.40% | 1.08% | 7.53% | NA |
| Indica III | 913 | 34.40% | 64.60% | 0.66% | 0.33% | NA |
| Indica Intermediate | 786 | 29.00% | 68.10% | 1.53% | 1.40% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 24.40% | 4.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922095856 | C -> DEL | N | N | silent_mutation | Average:65.532; most accessible tissue: Minghui63 flower, score: 78.235 | N | N | N | N |
| vg0922095856 | C -> A | LOC_Os09g38370.1 | upstream_gene_variant ; 555.0bp to feature; MODIFIER | silent_mutation | Average:65.532; most accessible tissue: Minghui63 flower, score: 78.235 | N | N | N | N |
| vg0922095856 | C -> A | LOC_Os09g38390.1 | upstream_gene_variant ; 2607.0bp to feature; MODIFIER | silent_mutation | Average:65.532; most accessible tissue: Minghui63 flower, score: 78.235 | N | N | N | N |
| vg0922095856 | C -> A | LOC_Os09g38360.1 | downstream_gene_variant ; 4498.0bp to feature; MODIFIER | silent_mutation | Average:65.532; most accessible tissue: Minghui63 flower, score: 78.235 | N | N | N | N |
| vg0922095856 | C -> A | LOC_Os09g38380.1 | downstream_gene_variant ; 228.0bp to feature; MODIFIER | silent_mutation | Average:65.532; most accessible tissue: Minghui63 flower, score: 78.235 | N | N | N | N |
| vg0922095856 | C -> A | LOC_Os09g38370-LOC_Os09g38380 | intergenic_region ; MODIFIER | silent_mutation | Average:65.532; most accessible tissue: Minghui63 flower, score: 78.235 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922095856 | NA | 3.13E-12 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922095856 | 2.18E-10 | NA | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922095856 | 1.33E-07 | 5.43E-09 | mr1865 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922095856 | NA | 4.24E-08 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922095856 | NA | 1.32E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922095856 | NA | 5.75E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922095856 | 8.72E-06 | 1.05E-09 | mr1629_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922095856 | 2.29E-11 | NA | mr1865_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922095856 | 4.45E-08 | 1.18E-09 | mr1865_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922095856 | NA | 8.60E-07 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |