Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0922095856:

Variant ID: vg0922095856 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22095856
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

AATGGAGATGTGCCAGTTTAAGATGCACTTTGTTTAACAATGTATGACGAGAAAAAAACATCGAAATAAAATGATATCTCGAATCTGTAAGTTAAGCCAC[C/A]
AGATATATTACTCAAATATAATATAAGATAAAAAGAAAATTTAACGACACAAAAAAGGTTCATACAAACTATGGAACTATACAAACGTGCCATCTAGATG

Reverse complement sequence

CATCTAGATGGCACGTTTGTATAGTTCCATAGTTTGTATGAACCTTTTTTGTGTCGTTAAATTTTCTTTTTATCTTATATTATATTTGAGTAATATATCT[G/T]
GTGGCTTAACTTACAGATTCGAGATATCATTTTATTTCGATGTTTTTTTCTCGTCATACATTGTTAAACAAAGTGCATCTTAAACTGGCACATCTCCATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.60%	43.50%	0.74%	1.12%	NA
All Indica	2759	29.60%	67.60%	1.05%	1.78%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	39.00%	59.90%	0.74%	0.37%	NA
Indica I	595	32.90%	66.10%	1.01%	0.00%	NA
Indica II	465	17.00%	74.40%	1.08%	7.53%	NA
Indica III	913	34.40%	64.60%	0.66%	0.33%	NA
Indica Intermediate	786	29.00%	68.10%	1.53%	1.40%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	67.80%	24.40%	4.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922095856	C -> DEL	N	N	silent_mutation	Average:65.532; most accessible tissue: Minghui63 flower, score: 78.235	N	N	N	N
vg0922095856	C -> A	LOC_Os09g38370.1	upstream_gene_variant ; 555.0bp to feature; MODIFIER	silent_mutation	Average:65.532; most accessible tissue: Minghui63 flower, score: 78.235	N	N	N	N
vg0922095856	C -> A	LOC_Os09g38390.1	upstream_gene_variant ; 2607.0bp to feature; MODIFIER	silent_mutation	Average:65.532; most accessible tissue: Minghui63 flower, score: 78.235	N	N	N	N
vg0922095856	C -> A	LOC_Os09g38360.1	downstream_gene_variant ; 4498.0bp to feature; MODIFIER	silent_mutation	Average:65.532; most accessible tissue: Minghui63 flower, score: 78.235	N	N	N	N
vg0922095856	C -> A	LOC_Os09g38380.1	downstream_gene_variant ; 228.0bp to feature; MODIFIER	silent_mutation	Average:65.532; most accessible tissue: Minghui63 flower, score: 78.235	N	N	N	N
vg0922095856	C -> A	LOC_Os09g38370-LOC_Os09g38380	intergenic_region ; MODIFIER	silent_mutation	Average:65.532; most accessible tissue: Minghui63 flower, score: 78.235	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922095856	NA	3.13E-12	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922095856	2.18E-10	NA	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922095856	1.33E-07	5.43E-09	mr1865	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922095856	NA	4.24E-08	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922095856	NA	1.32E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922095856	NA	5.75E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922095856	8.72E-06	1.05E-09	mr1629_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922095856	2.29E-11	NA	mr1865_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922095856	4.45E-08	1.18E-09	mr1865_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922095856	NA	8.60E-07	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251