\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922072019:

Variant ID: vg0922072019 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22072019
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


CGCAATCCACATGGGTGTGTATTATGGGGGAACGTGGGCCCATAGATCATGTATACCTAGCTTCCTCATGAAAGGAAATAAGAAAATGTTTTTAAGCTAG[A/C]
TATTTCCTTATAAATTATCTCAATTCTGATAGTACGGTGAGATCAAAACATTGGAGACCGATATGGTGGGGTTGTGCGCTTCACACAGGTGTATGGGGAC

Reverse complement sequence

GTCCCCATACACCTGTGTGAAGCGCACAACCCCACCATATCGGTCTCCAATGTTTTGATCTCACCGTACTATCAGAATTGAGATAATTTATAAGGAAATA[T/G]
CTAGCTTAAAAACATTTTCTTATTTCCTTTCATGAGGAAGCTAGGTATACATGATCTATGGGCCCACGTTCCCCCATAATACACACCCATGTGGATTGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 37.20% 0.19% 0.06% NA
All Indica  2759 97.60% 2.10% 0.18% 0.11% NA
All Japonica  1512 0.60% 99.40% 0.00% 0.00% NA
Aus  269 81.40% 18.60% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 97.60% 2.20% 0.00% 0.22% NA
Indica III  913 98.10% 1.60% 0.22% 0.00% NA
Indica Intermediate  786 96.10% 3.30% 0.38% 0.25% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 33.30% 62.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922072019 A -> DEL N N silent_mutation Average:56.663; most accessible tissue: Minghui63 root, score: 72.551 N N N N
vg0922072019 A -> C LOC_Os09g38340.1 upstream_gene_variant ; 1268.0bp to feature; MODIFIER silent_mutation Average:56.663; most accessible tissue: Minghui63 root, score: 72.551 N N N N
vg0922072019 A -> C LOC_Os09g38340.2 upstream_gene_variant ; 1569.0bp to feature; MODIFIER silent_mutation Average:56.663; most accessible tissue: Minghui63 root, score: 72.551 N N N N
vg0922072019 A -> C LOC_Os09g38340.3 upstream_gene_variant ; 1527.0bp to feature; MODIFIER silent_mutation Average:56.663; most accessible tissue: Minghui63 root, score: 72.551 N N N N
vg0922072019 A -> C LOC_Os09g38340-LOC_Os09g38350 intergenic_region ; MODIFIER silent_mutation Average:56.663; most accessible tissue: Minghui63 root, score: 72.551 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922072019 1.35E-06 NA mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 NA 3.57E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 NA 3.13E-48 mr1591 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 NA 4.48E-63 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 1.51E-06 1.35E-79 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 NA 6.68E-41 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 7.75E-11 5.92E-41 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 NA 1.13E-25 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 NA 1.46E-74 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 NA 9.64E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 NA 1.98E-26 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 NA 9.08E-14 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 NA 3.48E-21 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 NA 4.03E-83 mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 NA 8.72E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 NA 6.83E-37 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 3.11E-08 3.76E-96 mr1865_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 NA 1.18E-33 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922072019 NA 1.94E-40 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251