\
| Variant ID: vg0922061048 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 22061048 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 93. )
GGGATGAGGAAGAGAGTTAGAGAGGATGGATCTGAGGAGAGGGGTGAGATTCGATCCGTAACTGTGGATGAGAGGATAAGGGATAGGGATTATATACTAC[G/A]
TGTTTAATTTTAGTCCCGATTCATATTACCAAGCGGGACTAAAGATCATCTTGATCTTTAGTCCCGGTTATTAACACCAACCGAGACTAAAGATCCTCGG
CCGAGGATCTTTAGTCTCGGTTGGTGTTAATAACCGGGACTAAAGATCAAGATGATCTTTAGTCCCGCTTGGTAATATGAATCGGGACTAAAATTAAACA[C/T]
GTAGTATATAATCCCTATCCCTTATCCTCTCATCCACAGTTACGGATCGAATCTCACCCCTCTCCTCAGATCCATCCTCTCTAACTCTCTTCCTCATCCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.10% | 41.50% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 93.10% | 6.60% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 53.20% | 42.80% | 4.09% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.00% | 7.10% | 0.88% | 0.00% | NA |
| Indica Intermediate | 786 | 93.00% | 7.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 25.60% | 74.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0922061048 | G -> A | LOC_Os09g38330.1 | upstream_gene_variant ; 4019.0bp to feature; MODIFIER | silent_mutation | Average:58.415; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg0922061048 | G -> A | LOC_Os09g38340.1 | downstream_gene_variant ; 3406.0bp to feature; MODIFIER | silent_mutation | Average:58.415; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg0922061048 | G -> A | LOC_Os09g38340.2 | downstream_gene_variant ; 3406.0bp to feature; MODIFIER | silent_mutation | Average:58.415; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg0922061048 | G -> A | LOC_Os09g38340.3 | downstream_gene_variant ; 3406.0bp to feature; MODIFIER | silent_mutation | Average:58.415; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| vg0922061048 | G -> A | LOC_Os09g38330-LOC_Os09g38340 | intergenic_region ; MODIFIER | silent_mutation | Average:58.415; most accessible tissue: Minghui63 young leaf, score: 82.087 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0922061048 | 1.44E-08 | 2.81E-30 | mr1208 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922061048 | 1.35E-06 | 9.99E-08 | mr1208 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922061048 | 3.12E-07 | 3.11E-76 | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922061048 | 4.19E-06 | 1.35E-06 | mr1865 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922061048 | NA | 7.48E-16 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922061048 | 3.50E-07 | 6.00E-39 | mr1208_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922061048 | NA | 2.19E-09 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922061048 | NA | 1.09E-10 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0922061048 | NA | 1.57E-31 | mr1873_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |