Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0922061048:

Variant ID: vg0922061048 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 22061048
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

GGGATGAGGAAGAGAGTTAGAGAGGATGGATCTGAGGAGAGGGGTGAGATTCGATCCGTAACTGTGGATGAGAGGATAAGGGATAGGGATTATATACTAC[G/A]
TGTTTAATTTTAGTCCCGATTCATATTACCAAGCGGGACTAAAGATCATCTTGATCTTTAGTCCCGGTTATTAACACCAACCGAGACTAAAGATCCTCGG

Reverse complement sequence

CCGAGGATCTTTAGTCTCGGTTGGTGTTAATAACCGGGACTAAAGATCAAGATGATCTTTAGTCCCGCTTGGTAATATGAATCGGGACTAAAATTAAACA[C/T]
GTAGTATATAATCCCTATCCCTTATCCTCTCATCCACAGTTACGGATCGAATCTCACCCCTCTCCTCAGATCCATCCTCTCTAACTCTCTTCCTCATCCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.10%	41.50%	0.40%	0.00%	NA
All Indica	2759	93.10%	6.60%	0.29%	0.00%	NA
All Japonica	1512	0.50%	99.50%	0.00%	0.00%	NA
Aus	269	53.20%	42.80%	4.09%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	88.20%	11.80%	0.00%	0.00%	NA
Indica III	913	92.00%	7.10%	0.88%	0.00%	NA
Indica Intermediate	786	93.00%	7.00%	0.00%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	25.60%	74.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0922061048	G -> A	LOC_Os09g38330.1	upstream_gene_variant ; 4019.0bp to feature; MODIFIER	silent_mutation	Average:58.415; most accessible tissue: Minghui63 young leaf, score: 82.087	N	N	N	N
vg0922061048	G -> A	LOC_Os09g38340.1	downstream_gene_variant ; 3406.0bp to feature; MODIFIER	silent_mutation	Average:58.415; most accessible tissue: Minghui63 young leaf, score: 82.087	N	N	N	N
vg0922061048	G -> A	LOC_Os09g38340.2	downstream_gene_variant ; 3406.0bp to feature; MODIFIER	silent_mutation	Average:58.415; most accessible tissue: Minghui63 young leaf, score: 82.087	N	N	N	N
vg0922061048	G -> A	LOC_Os09g38340.3	downstream_gene_variant ; 3406.0bp to feature; MODIFIER	silent_mutation	Average:58.415; most accessible tissue: Minghui63 young leaf, score: 82.087	N	N	N	N
vg0922061048	G -> A	LOC_Os09g38330-LOC_Os09g38340	intergenic_region ; MODIFIER	silent_mutation	Average:58.415; most accessible tissue: Minghui63 young leaf, score: 82.087	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0922061048	1.44E-08	2.81E-30	mr1208	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922061048	1.35E-06	9.99E-08	mr1208	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922061048	3.12E-07	3.11E-76	mr1865	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922061048	4.19E-06	1.35E-06	mr1865	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922061048	NA	7.48E-16	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922061048	3.50E-07	6.00E-39	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922061048	NA	2.19E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922061048	NA	1.09E-10	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922061048	NA	1.57E-31	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251