\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0922061048:

Variant ID: vg0922061048 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 22061048
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


GGGATGAGGAAGAGAGTTAGAGAGGATGGATCTGAGGAGAGGGGTGAGATTCGATCCGTAACTGTGGATGAGAGGATAAGGGATAGGGATTATATACTAC[G/A]
TGTTTAATTTTAGTCCCGATTCATATTACCAAGCGGGACTAAAGATCATCTTGATCTTTAGTCCCGGTTATTAACACCAACCGAGACTAAAGATCCTCGG

Reverse complement sequence

CCGAGGATCTTTAGTCTCGGTTGGTGTTAATAACCGGGACTAAAGATCAAGATGATCTTTAGTCCCGCTTGGTAATATGAATCGGGACTAAAATTAAACA[C/T]
GTAGTATATAATCCCTATCCCTTATCCTCTCATCCACAGTTACGGATCGAATCTCACCCCTCTCCTCAGATCCATCCTCTCTAACTCTCTTCCTCATCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 41.50% 0.40% 0.00% NA
All Indica  2759 93.10% 6.60% 0.29% 0.00% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 53.20% 42.80% 4.09% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 88.20% 11.80% 0.00% 0.00% NA
Indica III  913 92.00% 7.10% 0.88% 0.00% NA
Indica Intermediate  786 93.00% 7.00% 0.00% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 25.60% 74.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0922061048 G -> A LOC_Os09g38330.1 upstream_gene_variant ; 4019.0bp to feature; MODIFIER silent_mutation Average:58.415; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0922061048 G -> A LOC_Os09g38340.1 downstream_gene_variant ; 3406.0bp to feature; MODIFIER silent_mutation Average:58.415; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0922061048 G -> A LOC_Os09g38340.2 downstream_gene_variant ; 3406.0bp to feature; MODIFIER silent_mutation Average:58.415; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0922061048 G -> A LOC_Os09g38340.3 downstream_gene_variant ; 3406.0bp to feature; MODIFIER silent_mutation Average:58.415; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0922061048 G -> A LOC_Os09g38330-LOC_Os09g38340 intergenic_region ; MODIFIER silent_mutation Average:58.415; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0922061048 1.44E-08 2.81E-30 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922061048 1.35E-06 9.99E-08 mr1208 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922061048 3.12E-07 3.11E-76 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922061048 4.19E-06 1.35E-06 mr1865 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922061048 NA 7.48E-16 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922061048 3.50E-07 6.00E-39 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922061048 NA 2.19E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922061048 NA 1.09E-10 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0922061048 NA 1.57E-31 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251