\
| Variant ID: vg0921976011 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 21976011 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 112. )
AAATGAGTAGTATTACAAGATAGAAATTTATCCCCATACGTTTTAAGTTTACTTAATCAACAACTAGCTGGGTGGCCCGCGCAATTGCGCGGCTAGCACC[C/T]
AAACAAAATCATATATTTTTTAGTATAATTTTACTTAAAATTTATTAAATAGCTATCTTATTGTCTTAAGACTTTGAAAGACCAAACCTTATCATCCTCG
CGAGGATGATAAGGTTTGGTCTTTCAAAGTCTTAAGACAATAAGATAGCTATTTAATAAATTTTAAGTAAAATTATACTAAAAAATATATGATTTTGTTT[G/A]
GGTGCTAGCCGCGCAATTGCGCGGGCCACCCAGCTAGTTGTTGATTAAGTAAACTTAAAACGTATGGGGATAAATTTCTATCTTGTAATACTACTCATTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.70% | 46.00% | 0.23% | 0.04% | NA |
| All Indica | 2759 | 86.70% | 12.90% | 0.33% | 0.07% | NA |
| All Japonica | 1512 | 0.50% | 99.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 35.30% | 64.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.40% | 10.40% | 0.00% | 0.17% | NA |
| Indica II | 465 | 88.00% | 11.20% | 0.86% | 0.00% | NA |
| Indica III | 913 | 84.10% | 15.60% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 86.90% | 12.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 32.20% | 66.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0921976011 | C -> DEL | N | N | silent_mutation | Average:42.285; most accessible tissue: Callus, score: 54.4 | N | N | N | N |
| vg0921976011 | C -> T | LOC_Os09g38150.1 | upstream_gene_variant ; 1766.0bp to feature; MODIFIER | silent_mutation | Average:42.285; most accessible tissue: Callus, score: 54.4 | N | N | N | N |
| vg0921976011 | C -> T | LOC_Os09g38150-LOC_Os09g38170 | intergenic_region ; MODIFIER | silent_mutation | Average:42.285; most accessible tissue: Callus, score: 54.4 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0921976011 | NA | 2.74E-10 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | NA | 2.23E-29 | mr1208 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | NA | 2.70E-11 | mr1379 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | NA | 1.01E-07 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | NA | 6.33E-10 | mr1581 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | 2.90E-08 | NA | mr1865 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | 7.26E-06 | 9.45E-06 | mr1865 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | NA | 3.69E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | NA | 2.08E-08 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | NA | 7.54E-06 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | NA | 4.32E-06 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | NA | 4.01E-08 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | NA | 5.96E-13 | mr1506_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | 5.55E-06 | 5.55E-06 | mr1506_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | NA | 8.17E-08 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | NA | 8.85E-08 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | NA | 8.32E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | NA | 7.04E-16 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921976011 | NA | 7.04E-07 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |