Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0921970933:

Variant ID: vg0921970933 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 21970933
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTTTTTAATTCCGTATTTAAGTTATTTATGGACTCTAAACTCTTCTTCCAATATTTTTTATTTTGAATTTTAGTTATTTCGAAATTATATTTTTATATG[A/G]
ACTCTAAACTCTAGTTTTAGTTTTTCTTTTTTTAATTCCGAATTTTAGTTAGTTCTAAATTATATTCTTGTATGGACTCTATTTTCCTCTTCCAATAATT

Reverse complement sequence

AATTATTGGAAGAGGAAAATAGAGTCCATACAAGAATATAATTTAGAACTAACTAAAATTCGGAATTAAAAAAAGAAAAACTAAAACTAGAGTTTAGAGT[T/C]
CATATAAAAATATAATTTCGAAATAACTAAAATTCAAAATAAAAAATATTGGAAGAAGAGTTTAGAGTCCATAAATAACTTAAATACGGAATTAAAAAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.50%	7.30%	4.51%	5.67%	NA
All Indica	2759	87.00%	0.40%	3.48%	9.21%	NA
All Japonica	1512	71.10%	21.70%	7.21%	0.00%	NA
Aus	269	96.30%	0.00%	0.37%	3.35%	NA
Indica I	595	83.70%	0.00%	8.74%	7.56%	NA
Indica II	465	80.60%	1.10%	3.01%	15.27%	NA
Indica III	913	92.90%	0.10%	0.00%	7.01%	NA
Indica Intermediate	786	86.30%	0.50%	3.82%	9.41%	NA
Temperate Japonica	767	55.50%	34.60%	9.91%	0.00%	NA
Tropical Japonica	504	92.50%	4.60%	2.98%	0.00%	NA
Japonica Intermediate	241	75.90%	16.60%	7.47%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	78.90%	8.90%	6.67%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0921970933	A -> G	LOC_Os09g38130.1	downstream_gene_variant ; 2711.0bp to feature; MODIFIER	silent_mutation	Average:28.282; most accessible tissue: Callus, score: 67.212	N	N	N	N
vg0921970933	A -> G	LOC_Os09g38150.1	downstream_gene_variant ; 1674.0bp to feature; MODIFIER	silent_mutation	Average:28.282; most accessible tissue: Callus, score: 67.212	N	N	N	N
vg0921970933	A -> G	LOC_Os09g38130.2	downstream_gene_variant ; 2711.0bp to feature; MODIFIER	silent_mutation	Average:28.282; most accessible tissue: Callus, score: 67.212	N	N	N	N
vg0921970933	A -> G	LOC_Os09g38130-LOC_Os09g38150	intergenic_region ; MODIFIER	silent_mutation	Average:28.282; most accessible tissue: Callus, score: 67.212	N	N	N	N
vg0921970933	A -> DEL	N	N	silent_mutation	Average:28.282; most accessible tissue: Callus, score: 67.212	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0921970933	2.66E-06	4.52E-09	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921970933	NA	9.81E-07	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921970933	4.03E-06	NA	mr1789	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921970933	NA	2.12E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921970933	NA	1.49E-09	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251