\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921970933:

Variant ID: vg0921970933 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21970933
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTTTTAATTCCGTATTTAAGTTATTTATGGACTCTAAACTCTTCTTCCAATATTTTTTATTTTGAATTTTAGTTATTTCGAAATTATATTTTTATATG[A/G]
ACTCTAAACTCTAGTTTTAGTTTTTCTTTTTTTAATTCCGAATTTTAGTTAGTTCTAAATTATATTCTTGTATGGACTCTATTTTCCTCTTCCAATAATT

Reverse complement sequence

AATTATTGGAAGAGGAAAATAGAGTCCATACAAGAATATAATTTAGAACTAACTAAAATTCGGAATTAAAAAAAGAAAAACTAAAACTAGAGTTTAGAGT[T/C]
CATATAAAAATATAATTTCGAAATAACTAAAATTCAAAATAAAAAATATTGGAAGAAGAGTTTAGAGTCCATAAATAACTTAAATACGGAATTAAAAAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.50% 7.30% 4.51% 5.67% NA
All Indica  2759 87.00% 0.40% 3.48% 9.21% NA
All Japonica  1512 71.10% 21.70% 7.21% 0.00% NA
Aus  269 96.30% 0.00% 0.37% 3.35% NA
Indica I  595 83.70% 0.00% 8.74% 7.56% NA
Indica II  465 80.60% 1.10% 3.01% 15.27% NA
Indica III  913 92.90% 0.10% 0.00% 7.01% NA
Indica Intermediate  786 86.30% 0.50% 3.82% 9.41% NA
Temperate Japonica  767 55.50% 34.60% 9.91% 0.00% NA
Tropical Japonica  504 92.50% 4.60% 2.98% 0.00% NA
Japonica Intermediate  241 75.90% 16.60% 7.47% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 78.90% 8.90% 6.67% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921970933 A -> G LOC_Os09g38130.1 downstream_gene_variant ; 2711.0bp to feature; MODIFIER silent_mutation Average:28.282; most accessible tissue: Callus, score: 67.212 N N N N
vg0921970933 A -> G LOC_Os09g38150.1 downstream_gene_variant ; 1674.0bp to feature; MODIFIER silent_mutation Average:28.282; most accessible tissue: Callus, score: 67.212 N N N N
vg0921970933 A -> G LOC_Os09g38130.2 downstream_gene_variant ; 2711.0bp to feature; MODIFIER silent_mutation Average:28.282; most accessible tissue: Callus, score: 67.212 N N N N
vg0921970933 A -> G LOC_Os09g38130-LOC_Os09g38150 intergenic_region ; MODIFIER silent_mutation Average:28.282; most accessible tissue: Callus, score: 67.212 N N N N
vg0921970933 A -> DEL N N silent_mutation Average:28.282; most accessible tissue: Callus, score: 67.212 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921970933 2.66E-06 4.52E-09 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921970933 NA 9.81E-07 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921970933 4.03E-06 NA mr1789 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921970933 NA 2.12E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921970933 NA 1.49E-09 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251