| Variant ID: vg0921970933 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 21970933 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTTTTTAATTCCGTATTTAAGTTATTTATGGACTCTAAACTCTTCTTCCAATATTTTTTATTTTGAATTTTAGTTATTTCGAAATTATATTTTTATATG[A/G]
ACTCTAAACTCTAGTTTTAGTTTTTCTTTTTTTAATTCCGAATTTTAGTTAGTTCTAAATTATATTCTTGTATGGACTCTATTTTCCTCTTCCAATAATT
AATTATTGGAAGAGGAAAATAGAGTCCATACAAGAATATAATTTAGAACTAACTAAAATTCGGAATTAAAAAAAGAAAAACTAAAACTAGAGTTTAGAGT[T/C]
CATATAAAAATATAATTTCGAAATAACTAAAATTCAAAATAAAAAATATTGGAAGAAGAGTTTAGAGTCCATAAATAACTTAAATACGGAATTAAAAAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.50% | 7.30% | 4.51% | 5.67% | NA |
| All Indica | 2759 | 87.00% | 0.40% | 3.48% | 9.21% | NA |
| All Japonica | 1512 | 71.10% | 21.70% | 7.21% | 0.00% | NA |
| Aus | 269 | 96.30% | 0.00% | 0.37% | 3.35% | NA |
| Indica I | 595 | 83.70% | 0.00% | 8.74% | 7.56% | NA |
| Indica II | 465 | 80.60% | 1.10% | 3.01% | 15.27% | NA |
| Indica III | 913 | 92.90% | 0.10% | 0.00% | 7.01% | NA |
| Indica Intermediate | 786 | 86.30% | 0.50% | 3.82% | 9.41% | NA |
| Temperate Japonica | 767 | 55.50% | 34.60% | 9.91% | 0.00% | NA |
| Tropical Japonica | 504 | 92.50% | 4.60% | 2.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.90% | 16.60% | 7.47% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 8.90% | 6.67% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0921970933 | A -> G | LOC_Os09g38130.1 | downstream_gene_variant ; 2711.0bp to feature; MODIFIER | silent_mutation | Average:28.282; most accessible tissue: Callus, score: 67.212 | N | N | N | N |
| vg0921970933 | A -> G | LOC_Os09g38150.1 | downstream_gene_variant ; 1674.0bp to feature; MODIFIER | silent_mutation | Average:28.282; most accessible tissue: Callus, score: 67.212 | N | N | N | N |
| vg0921970933 | A -> G | LOC_Os09g38130.2 | downstream_gene_variant ; 2711.0bp to feature; MODIFIER | silent_mutation | Average:28.282; most accessible tissue: Callus, score: 67.212 | N | N | N | N |
| vg0921970933 | A -> G | LOC_Os09g38130-LOC_Os09g38150 | intergenic_region ; MODIFIER | silent_mutation | Average:28.282; most accessible tissue: Callus, score: 67.212 | N | N | N | N |
| vg0921970933 | A -> DEL | N | N | silent_mutation | Average:28.282; most accessible tissue: Callus, score: 67.212 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0921970933 | 2.66E-06 | 4.52E-09 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921970933 | NA | 9.81E-07 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921970933 | 4.03E-06 | NA | mr1789 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921970933 | NA | 2.12E-06 | mr1826 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921970933 | NA | 1.49E-09 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |