\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921954182:

Variant ID: vg0921954182 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21954182
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGAAAAAGTCGGCGCCGCGTCCGCCGTTGAGAACACCTCTGGCGTCAAGGGTGCTGACGGCAAGGCCGTCAAGGCGAAGGGCTCACGGTGAACACACA[C/T]
ACAAAACTCACGTCGCCGGCAAGAACACACACACAAAACTCCCGTGAACATAGGAATGAACACCATCTTGTTTGGTGCTGCTAACTAGGCAGCTTTTTCC

Reverse complement sequence

GGAAAAAGCTGCCTAGTTAGCAGCACCAAACAAGATGGTGTTCATTCCTATGTTCACGGGAGTTTTGTGTGTGTGTTCTTGCCGGCGACGTGAGTTTTGT[G/A]
TGTGTGTTCACCGTGAGCCCTTCGCCTTGACGGCCTTGCCGTCAGCACCCTTGACGCCAGAGGTGTTCTCAACGGCGGACGCGGCGCCGACTTTTTCAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 2.20% 8.97% 30.47% NA
All Indica  2759 30.30% 3.70% 14.93% 51.03% NA
All Japonica  1512 99.80% 0.00% 0.13% 0.07% NA
Aus  269 92.60% 0.00% 2.23% 5.20% NA
Indica I  595 20.20% 3.50% 12.10% 64.20% NA
Indica II  465 32.90% 3.20% 11.83% 52.04% NA
Indica III  913 35.70% 4.60% 18.07% 41.62% NA
Indica Intermediate  786 30.30% 3.10% 15.27% 51.40% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 83.30% 0.00% 4.44% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921954182 C -> DEL N N silent_mutation Average:82.478; most accessible tissue: Minghui63 panicle, score: 95.915 N N N N
vg0921954182 C -> T LOC_Os09g38100.1 upstream_gene_variant ; 1665.0bp to feature; MODIFIER silent_mutation Average:82.478; most accessible tissue: Minghui63 panicle, score: 95.915 N N N N
vg0921954182 C -> T LOC_Os09g38104.1 upstream_gene_variant ; 393.0bp to feature; MODIFIER silent_mutation Average:82.478; most accessible tissue: Minghui63 panicle, score: 95.915 N N N N
vg0921954182 C -> T LOC_Os09g38110.1 downstream_gene_variant ; 2210.0bp to feature; MODIFIER silent_mutation Average:82.478; most accessible tissue: Minghui63 panicle, score: 95.915 N N N N
vg0921954182 C -> T LOC_Os09g38100-LOC_Os09g38104 intergenic_region ; MODIFIER silent_mutation Average:82.478; most accessible tissue: Minghui63 panicle, score: 95.915 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0921954182 C T 0.0 -0.01 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921954182 NA 1.61E-17 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 7.02E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 1.29E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 3.76E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 1.97E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 7.54E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 9.06E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 3.97E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 4.54E-06 4.54E-06 mr1279_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 4.09E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 4.02E-07 4.02E-07 mr1313_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 6.42E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 1.15E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 3.47E-07 3.47E-07 mr1473_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 3.06E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 3.47E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 8.84E-12 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 9.42E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 3.13E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 3.87E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 5.53E-07 5.53E-07 mr1630_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 1.66E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 9.31E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 2.28E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 8.81E-23 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 9.13E-06 9.58E-09 mr1824_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 1.51E-11 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 1.73E-18 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 9.17E-21 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921954182 NA 5.10E-22 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251