\
| Variant ID: vg0921842785 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 21842785 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAGTACATTTTTTCTAAAATCAATTACTACATCCGTTGTTGTTCATAGGACGTAGGAGTACTTTGATGTCTAAAAGTCAAATTCTCTATAGATTTTGATC[A/G]
GTTGGTATAAAAATTCCTCTATGATGAGTCTACCAAGAAATTCATGTTTTAGACTAACAAGGTAATCCATTCATGTTTTAGACTAACAAGGTAATCCCTC
GAGGGATTACCTTGTTAGTCTAAAACATGAATGGATTACCTTGTTAGTCTAAAACATGAATTTCTTGGTAGACTCATCATAGAGGAATTTTTATACCAAC[T/C]
GATCAAAATCTATAGAGAATTTGACTTTTAGACATCAAAGTACTCCTACGTCCTATGAACAACAACGGATGTAGTAATTGATTTTAGAAAAAATGTACTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.30% | 8.60% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 91.20% | 8.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 48.00% | 52.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.10% | 8.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 81.70% | 18.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.30% | 5.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0921842785 | A -> G | LOC_Os09g37890.1 | downstream_gene_variant ; 3797.0bp to feature; MODIFIER | silent_mutation | Average:58.67; most accessible tissue: Callus, score: 81.319 | N | N | N | N |
| vg0921842785 | A -> G | LOC_Os09g37880.1 | intron_variant ; MODIFIER | silent_mutation | Average:58.67; most accessible tissue: Callus, score: 81.319 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0921842785 | NA | 6.50E-07 | mr1417 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921842785 | NA | 2.33E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921842785 | 1.44E-06 | NA | mr1622_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921842785 | NA | 2.74E-06 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921842785 | NA | 4.49E-07 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |