\
| Variant ID: vg0921835488 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 21835488 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGGGGCGAAGGGAGTACTCCGTTTCCTATGACTATGGATGGGATGTCCAAATTGTTGAAGATGGTGTGTTGGGCGACTTCGGTCATCATCTTCTTTGCGG[G/C]
CATGCTCAGCTGCAAGTGCAACCATGGAAGCTCGGAGAAATCGCTTCTGGCTACCTCCCCAATCGAAACGCCTGATATTGAAAATTCTGCTCCAACTGCT
AGCAGTTGGAGCAGAATTTTCAATATCAGGCGTTTCGATTGGGGAGGTAGCCAGAAGCGATTTCTCCGAGCTTCCATGGTTGCACTTGCAGCTGAGCATG[C/G]
CCGCAAAGAAGATGATGACCGAAGTCGCCCAACACACCATCTTCAACAATTTGGACATCCCATCCATAGTCATAGGAAACGGAGTACTCCCTTCGCCCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.00% | 35.10% | 0.78% | 2.16% | NA |
| All Indica | 2759 | 96.40% | 1.40% | 0.54% | 1.70% | NA |
| All Japonica | 1512 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 70.30% | 1.90% | 7.81% | 20.07% | NA |
| Indica I | 595 | 90.80% | 1.00% | 1.85% | 6.39% | NA |
| Indica II | 465 | 97.00% | 2.60% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.30% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 96.70% | 2.20% | 0.13% | 1.02% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 54.40% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0921835488 | G -> DEL | LOC_Os09g37870.1 | N | frameshift_variant | Average:47.384; most accessible tissue: Zhenshan97 flower, score: 78.132 | N | N | N | N |
| vg0921835488 | G -> C | LOC_Os09g37870.1 | missense_variant ; p.Gly359Ala; MODERATE | nonsynonymous_codon ; G359A | Average:47.384; most accessible tissue: Zhenshan97 flower, score: 78.132 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0921835488 | NA | 1.09E-26 | mr1024 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | 5.04E-06 | NA | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | NA | 2.84E-28 | mr1148 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | NA | 2.21E-15 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | NA | 2.11E-15 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | NA | 4.94E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | NA | 8.88E-13 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | NA | 8.51E-16 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | NA | 4.47E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | NA | 4.47E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | NA | 1.51E-40 | mr1509 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | NA | 7.16E-09 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | 3.90E-06 | NA | mr1603 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | NA | 3.08E-07 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | NA | 5.50E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | NA | 1.80E-08 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | NA | 1.94E-06 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | NA | 3.74E-12 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921835488 | NA | 7.78E-23 | mr1386_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |