\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921722907:

Variant ID: vg0921722907 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21722907
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CATGGCCAACATAATTTTCGTGGGCTCACCACTGTTAGAAAGTGAAATCGCAATACGAAAGGAAAAGGTTCAATTTAGCTCCCTTAAATATAAACAAGAT[C/A]
TAATTCATACCTCTCAACCGCAAAACCAAATATATTGACTCTTTCAAGTATTAAAACTATGCAAAATGACTCCCTTAGCTATTTTAGTGTGATTTTCGCT

Reverse complement sequence

AGCGAAAATCACACTAAAATAGCTAAGGGAGTCATTTTGCATAGTTTTAATACTTGAAAGAGTCAATATATTTGGTTTTGCGGTTGAGAGGTATGAATTA[G/T]
ATCTTGTTTATATTTAAGGGAGCTAAATTGAACCTTTTCCTTTCGTATTGCGATTTCACTTTCTAACAGTGGTGAGCCCACGAAAATTATGTTGGCCATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 2.20% 0.28% 2.71% NA
All Indica  2759 97.90% 0.00% 0.11% 1.99% NA
All Japonica  1512 92.70% 6.70% 0.66% 0.00% NA
Aus  269 73.60% 0.00% 0.00% 26.39% NA
Indica I  595 91.80% 0.00% 0.34% 7.90% NA
Indica II  465 99.40% 0.20% 0.22% 0.22% NA
Indica III  913 99.90% 0.00% 0.00% 0.11% NA
Indica Intermediate  786 99.20% 0.00% 0.00% 0.76% NA
Temperate Japonica  767 97.70% 1.80% 0.52% 0.00% NA
Tropical Japonica  504 84.30% 14.70% 0.99% 0.00% NA
Japonica Intermediate  241 94.20% 5.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 3.30% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921722907 C -> DEL N N silent_mutation Average:54.453; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg0921722907 C -> A LOC_Os09g37700.1 upstream_gene_variant ; 4894.0bp to feature; MODIFIER silent_mutation Average:54.453; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg0921722907 C -> A LOC_Os09g37690.1 downstream_gene_variant ; 1432.0bp to feature; MODIFIER silent_mutation Average:54.453; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg0921722907 C -> A LOC_Os09g37680-LOC_Os09g37690 intergenic_region ; MODIFIER silent_mutation Average:54.453; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921722907 NA 1.85E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 2.88E-06 1.79E-08 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 6.97E-06 2.19E-08 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 NA 3.82E-07 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 NA 3.83E-08 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 NA 6.30E-07 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 4.97E-08 4.97E-08 mr1424_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 8.13E-06 2.27E-08 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 NA 6.87E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 3.59E-08 3.59E-08 mr1562_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 NA 8.96E-07 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 NA 6.21E-06 mr1600_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 NA 2.30E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 4.71E-06 4.71E-06 mr1637_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 NA 2.32E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 NA 5.69E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 NA 2.20E-07 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 NA 1.46E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 NA 1.66E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 2.59E-06 7.09E-10 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 NA 3.44E-10 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921722907 3.14E-06 3.07E-08 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251