\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921645479:

Variant ID: vg0921645479 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 21645479
Reference Allele: GAlternative Allele: T,GTTT
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGTACTCCAGTGCACAGACTCAAGGTGTGTTTAGTTGGGGGAAAAGGAAATTTTTAGGTGTCACATTAGACGTTTGATCGGATATCGGAAGGGGTTTTC[G/T,GTTT]
GACACGAATAAAAAAACTAATTTCAGAACTCGCCTGGAAACCACGAGACGAATCTTTTGAGACTAATTAAGCCATCATTAGCACATGTGGGTTACTGTAG

Reverse complement sequence

CTACAGTAACCCACATGTGCTAATGATGGCTTAATTAGTCTCAAAAGATTCGTCTCGTGGTTTCCAGGCGAGTTCTGAAATTAGTTTTTTTATTCGTGTC[C/A,AAAC]
GAAAACCCCTTCCGATATCCGATCAAACGTCTAATGTGACACCTAAAAATTTCCTTTTCCCCCAACTAAACACACCTTGAGTCTGTGCACTGGAGTACAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.40% 43.00% 0.32% 0.23% GTTT: 0.02%
All Indica  2759 87.20% 11.90% 0.47% 0.40% GTTT: 0.04%
All Japonica  1512 0.30% 99.50% 0.13% 0.00% NA
Aus  269 80.30% 19.70% 0.00% 0.00% NA
Indica I  595 97.10% 2.00% 0.50% 0.34% NA
Indica II  465 76.30% 21.90% 0.65% 1.08% NA
Indica III  913 85.90% 13.70% 0.22% 0.11% GTTT: 0.11%
Indica Intermediate  786 87.50% 11.50% 0.64% 0.38% NA
Temperate Japonica  767 0.00% 100.00% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 98.30% 0.83% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 32.20% 67.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921645479 G -> DEL N N silent_mutation Average:61.037; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg0921645479 G -> T LOC_Os09g37540.1 downstream_gene_variant ; 582.0bp to feature; MODIFIER silent_mutation Average:61.037; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg0921645479 G -> T LOC_Os09g37550.1 downstream_gene_variant ; 4576.0bp to feature; MODIFIER silent_mutation Average:61.037; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg0921645479 G -> T LOC_Os09g37540-LOC_Os09g37550 intergenic_region ; MODIFIER silent_mutation Average:61.037; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg0921645479 G -> GTTT LOC_Os09g37540.1 downstream_gene_variant ; 583.0bp to feature; MODIFIER silent_mutation Average:61.037; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg0921645479 G -> GTTT LOC_Os09g37550.1 downstream_gene_variant ; 4575.0bp to feature; MODIFIER silent_mutation Average:61.037; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg0921645479 G -> GTTT LOC_Os09g37540-LOC_Os09g37550 intergenic_region ; MODIFIER silent_mutation Average:61.037; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0921645479 G GTTT 0.35 0.01 0.02 0.11 0.18 0.19
vg0921645479 G T -0.05 -0.01 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921645479 NA 6.80E-11 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921645479 NA 3.25E-11 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921645479 2.62E-06 3.86E-12 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921645479 6.24E-07 1.15E-12 mr1142 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921645479 9.13E-08 3.31E-11 mr1489 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921645479 1.72E-07 1.28E-12 mr1491 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921645479 NA 4.26E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921645479 NA 4.02E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251