\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921630500:

Variant ID: vg0921630500 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21630500
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCTCACTCCACCACCCCACACCAAAATTCCACGCCACCGAGGCACCGATCCCAGCAAGAAAAAAAAAGAGAAAAGAGAAAAAGAAACAGCCAAACTCA[A/G]
CCGAACAGAAAAGCCCAGAAAACACACATCACAAACCCCCCCCCCCCCCCCCCCCCCAAAAAAAACGCCGATTAAGACGAAGAAAAAGGGTGAAACCCAA

Reverse complement sequence

TTGGGTTTCACCCTTTTTCTTCGTCTTAATCGGCGTTTTTTTTGGGGGGGGGGGGGGGGGGGGGGTTTGTGATGTGTGTTTTCTGGGCTTTTCTGTTCGG[T/C]
TGAGTTTGGCTGTTTCTTTTTCTCTTTTCTCTTTTTTTTTCTTGCTGGGATCGGTGCCTCGGTGGCGTGGAATTTTGGTGTGGGGTGGTGGAGTGAGGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 44.10% 0.40% 0.00% NA
All Indica  2759 88.10% 11.30% 0.65% 0.00% NA
All Japonica  1512 0.30% 99.70% 0.07% 0.00% NA
Aus  269 56.10% 43.90% 0.00% 0.00% NA
Indica I  595 90.30% 8.40% 1.34% 0.00% NA
Indica II  465 84.10% 15.30% 0.65% 0.00% NA
Indica III  913 88.30% 11.50% 0.22% 0.00% NA
Indica Intermediate  786 88.50% 10.80% 0.64% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.20% 99.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 98.80% 0.41% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 31.10% 68.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921630500 A -> G LOC_Os09g37520.1 upstream_gene_variant ; 318.0bp to feature; MODIFIER silent_mutation Average:92.456; most accessible tissue: Callus, score: 97.393 N N N N
vg0921630500 A -> G LOC_Os09g37510-LOC_Os09g37520 intergenic_region ; MODIFIER silent_mutation Average:92.456; most accessible tissue: Callus, score: 97.393 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0921630500 A G 0.04 0.04 0.04 0.03 0.05 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921630500 NA 2.04E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921630500 NA 6.92E-12 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921630500 NA 6.36E-14 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921630500 NA 2.42E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921630500 NA 8.58E-14 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921630500 1.67E-06 1.67E-06 mr1312_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921630500 NA 2.52E-10 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921630500 NA 1.17E-14 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921630500 NA 1.01E-13 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921630500 NA 3.62E-15 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921630500 NA 3.20E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921630500 NA 2.91E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921630500 NA 1.97E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921630500 NA 7.21E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921630500 NA 3.87E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251