\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921533165:

Variant ID: vg0921533165 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21533165
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CTATACTTAATTTCATCCATTGCAATTATATTTGTGGGCTCTGCATGCTCTTCCGCTTATTATTAGTACTTGAGCAAGTTTAATAGGAGCCAATTGCTAG[C/T]
TTTAATTTATCTATAGCCAATATAATAATCAATTCATACAATAGTTGTTTAATATACTACTAATATATAGTCCCACCTATTATACACACATTGTGTCTTA

Reverse complement sequence

TAAGACACAATGTGTGTATAATAGGTGGGACTATATATTAGTAGTATATTAAACAACTATTGTATGAATTGATTATTATATTGGCTATAGATAAATTAAA[G/A]
CTAGCAATTGGCTCCTATTAAACTTGCTCAAGTACTAATAATAAGCGGAAGAGCATGCAGAGCCCACAAATATAATTGCAATGGATGAAATTAAGTATAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 40.80% 0.85% 0.00% NA
All Indica  2759 34.90% 64.40% 0.62% 0.00% NA
All Japonica  1512 97.30% 1.70% 1.06% 0.00% NA
Aus  269 69.10% 29.40% 1.49% 0.00% NA
Indica I  595 15.60% 83.70% 0.67% 0.00% NA
Indica II  465 37.00% 61.50% 1.51% 0.00% NA
Indica III  913 42.20% 57.70% 0.11% 0.00% NA
Indica Intermediate  786 39.90% 59.40% 0.64% 0.00% NA
Temperate Japonica  767 97.50% 1.00% 1.43% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 91.70% 6.20% 2.07% 0.00% NA
VI/Aromatic  96 71.90% 26.00% 2.08% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921533165 C -> T LOC_Os09g37270.1 upstream_gene_variant ; 3299.0bp to feature; MODIFIER silent_mutation Average:84.337; most accessible tissue: Callus, score: 95.59 N N N N
vg0921533165 C -> T LOC_Os09g37270.2 upstream_gene_variant ; 3299.0bp to feature; MODIFIER silent_mutation Average:84.337; most accessible tissue: Callus, score: 95.59 N N N N
vg0921533165 C -> T LOC_Os09g37280.1 downstream_gene_variant ; 4823.0bp to feature; MODIFIER silent_mutation Average:84.337; most accessible tissue: Callus, score: 95.59 N N N N
vg0921533165 C -> T LOC_Os09g37280.2 downstream_gene_variant ; 4715.0bp to feature; MODIFIER silent_mutation Average:84.337; most accessible tissue: Callus, score: 95.59 N N N N
vg0921533165 C -> T LOC_Os09g37270-LOC_Os09g37280 intergenic_region ; MODIFIER silent_mutation Average:84.337; most accessible tissue: Callus, score: 95.59 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0921533165 C T -0.1 -0.05 -0.03 -0.02 -0.05 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921533165 5.78E-06 3.90E-24 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 2.57E-07 2.42E-07 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 NA 1.53E-07 mr1004 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 NA 2.30E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 9.13E-07 6.70E-12 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 4.64E-06 2.16E-11 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 NA 8.11E-24 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 2.76E-07 4.58E-08 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 NA 1.08E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 5.37E-07 1.36E-12 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 1.99E-07 1.26E-10 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 2.37E-06 NA mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 7.64E-06 7.73E-10 mr1004_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 4.98E-10 5.57E-08 mr1006_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 2.62E-09 2.41E-15 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 NA 2.91E-07 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 2.23E-10 3.38E-36 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 2.60E-10 7.03E-12 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 5.56E-06 NA mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 2.63E-09 8.63E-14 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 2.70E-07 NA mr1986_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921533165 7.76E-07 8.23E-09 mr1986_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251