Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921524582:

Variant ID: vg0921524582 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21524582
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACACAATGAGTAATAAATAAATGAATAAATTATATCAGTGATAGAAGAACTTAACATGGGGGTACAACCTACTATAAAAACATATTAAACATGATGCAC[T/G]
AACTTGTCTAATATGTACGAACCATAGCCAAATGAGCATACCATAATTAATCTTATTGAGTTAAACTACAGCTAGTTAATGTATATTCACAGTCAAATTT

Reverse complement sequence

AAATTTGACTGTGAATATACATTAACTAGCTGTAGTTTAACTCAATAAGATTAATTATGGTATGCTCATTTGGCTATGGTTCGTACATATTAGACAAGTT[A/C]
GTGCATCATGTTTAATATGTTTTTATAGTAGGTTGTACCCCCATGTTAAGTTCTTCTATCACTGATATAATTTATTCATTTATTTATTACTCATTGTGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 29.60% 2.18% 0.00% NA
All Indica  2759 66.60% 32.90% 0.47% 0.00% NA
All Japonica  1512 64.40% 30.00% 5.69% 0.00% NA
Aus  269 95.20% 4.50% 0.37% 0.00% NA
Indica I  595 85.40% 14.30% 0.34% 0.00% NA
Indica II  465 65.20% 34.00% 0.86% 0.00% NA
Indica III  913 57.60% 42.10% 0.33% 0.00% NA
Indica Intermediate  786 63.70% 35.80% 0.51% 0.00% NA
Temperate Japonica  767 39.20% 51.20% 9.52% 0.00% NA
Tropical Japonica  504 92.70% 6.20% 1.19% 0.00% NA
Japonica Intermediate  241 85.10% 12.00% 2.90% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 70.00% 27.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921524582 T -> G LOC_Os09g37270.1 downstream_gene_variant ; 1368.0bp to feature; MODIFIER silent_mutation Average:67.965; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg0921524582 T -> G LOC_Os09g37270.2 downstream_gene_variant ; 1394.0bp to feature; MODIFIER silent_mutation Average:67.965; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg0921524582 T -> G LOC_Os09g37260.1 intron_variant ; MODIFIER silent_mutation Average:67.965; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0921524582 T G 0.0 0.0 0.0 -0.02 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921524582 NA 4.55E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0921524582 NA 5.03E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921524582 NA 6.89E-08 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921524582 NA 2.79E-11 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921524582 3.72E-06 NA mr1670_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921524582 NA 1.65E-07 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921524582 NA 2.91E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251