\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921462199:

Variant ID: vg0921462199 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21462199
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.52, G: 0.47, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AATAAAAAAAGGTCAACCATATAAAATTGATATTATTAGATTTATCAATAAACAAACTATCATAATATTAACTCTTTTTATTTTTTAGATAATGGAAATG[T/G]
ATTACATCTCTGGCTTCTGTCACAAGACACACAGCCATAAGTTTAATAGTAATAAAAAGGTAAGATAAAATTAAATCAAAATGAGACACACAGCCATAAT

Reverse complement sequence

ATTATGGCTGTGTGTCTCATTTTGATTTAATTTTATCTTACCTTTTTATTACTATTAAACTTATGGCTGTGTGTCTTGTGACAGAAGCCAGAGATGTAAT[A/C]
CATTTCCATTATCTAAAAAATAAAAAGAGTTAATATTATGATAGTTTGTTTATTGATAAATCTAATAATATCAATTTTATATGGTTGACCTTTTTTTATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 21.20% 0.21% 0.04% NA
All Indica  2759 64.60% 35.00% 0.33% 0.07% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 91.10% 8.90% 0.00% 0.00% NA
Indica I  595 76.00% 23.90% 0.17% 0.00% NA
Indica II  465 66.00% 33.30% 0.43% 0.22% NA
Indica III  913 57.20% 42.50% 0.22% 0.11% NA
Indica Intermediate  786 63.90% 35.60% 0.51% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921462199 T -> G LOC_Os09g37200.1 upstream_gene_variant ; 1420.0bp to feature; MODIFIER silent_mutation Average:31.085; most accessible tissue: Callus, score: 72.653 N N N N
vg0921462199 T -> G LOC_Os09g37180-LOC_Os09g37200 intergenic_region ; MODIFIER silent_mutation Average:31.085; most accessible tissue: Callus, score: 72.653 N N N N
vg0921462199 T -> DEL N N silent_mutation Average:31.085; most accessible tissue: Callus, score: 72.653 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921462199 3.51E-07 NA mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 4.10E-06 1.03E-08 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 6.46E-06 4.88E-09 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 NA 5.06E-08 mr1004 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 1.12E-11 3.38E-16 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 1.11E-09 9.09E-17 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 2.26E-10 2.07E-15 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 4.02E-09 5.94E-16 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 NA 4.63E-07 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 1.31E-07 NA mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 8.89E-07 2.43E-10 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 1.20E-11 1.53E-16 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 1.11E-09 3.74E-17 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 9.89E-08 NA mr1536 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 6.25E-08 2.65E-14 mr1536 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 2.19E-08 3.00E-13 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 1.82E-06 1.26E-08 mr1004_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 1.08E-15 4.27E-19 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 1.66E-12 1.14E-18 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 8.82E-06 NA mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 NA 5.29E-06 mr1010_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 4.99E-12 NA mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 2.45E-10 6.79E-14 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 1.13E-10 NA mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 1.06E-10 8.87E-18 mr1536_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 1.43E-06 NA mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 4.67E-08 1.67E-13 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199 4.24E-07 1.90E-08 mr1986_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251