Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921462199:

Variant ID: vg0921462199 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 21462199
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.52, G: 0.47, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

AATAAAAAAAGGTCAACCATATAAAATTGATATTATTAGATTTATCAATAAACAAACTATCATAATATTAACTCTTTTTATTTTTTAGATAATGGAAATG[T/G]
ATTACATCTCTGGCTTCTGTCACAAGACACACAGCCATAAGTTTAATAGTAATAAAAAGGTAAGATAAAATTAAATCAAAATGAGACACACAGCCATAAT

Reverse complement sequence

ATTATGGCTGTGTGTCTCATTTTGATTTAATTTTATCTTACCTTTTTATTACTATTAAACTTATGGCTGTGTGTCTTGTGACAGAAGCCAGAGATGTAAT[A/C]
CATTTCCATTATCTAAAAAATAAAAAGAGTTAATATTATGATAGTTTGTTTATTGATAAATCTAATAATATCAATTTTATATGGTTGACCTTTTTTTATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.60%	21.20%	0.21%	0.04%	NA
All Indica	2759	64.60%	35.00%	0.33%	0.07%	NA
All Japonica	1512	99.90%	0.10%	0.07%	0.00%	NA
Aus	269	91.10%	8.90%	0.00%	0.00%	NA
Indica I	595	76.00%	23.90%	0.17%	0.00%	NA
Indica II	465	66.00%	33.30%	0.43%	0.22%	NA
Indica III	913	57.20%	42.50%	0.22%	0.11%	NA
Indica Intermediate	786	63.90%	35.60%	0.51%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0921462199	T -> G	LOC_Os09g37200.1	upstream_gene_variant ; 1420.0bp to feature; MODIFIER	silent_mutation	Average:31.085; most accessible tissue: Callus, score: 72.653	N	N	N	N
vg0921462199	T -> G	LOC_Os09g37180-LOC_Os09g37200	intergenic_region ; MODIFIER	silent_mutation	Average:31.085; most accessible tissue: Callus, score: 72.653	N	N	N	N
vg0921462199	T -> DEL	N	N	silent_mutation	Average:31.085; most accessible tissue: Callus, score: 72.653	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0921462199	3.51E-07	NA	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	4.10E-06	1.03E-08	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	6.46E-06	4.88E-09	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	NA	5.06E-08	mr1004	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	1.12E-11	3.38E-16	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	1.11E-09	9.09E-17	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	2.26E-10	2.07E-15	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	4.02E-09	5.94E-16	mr1007	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	NA	4.63E-07	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	1.31E-07	NA	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	8.89E-07	2.43E-10	mr1051	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	1.20E-11	1.53E-16	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	1.11E-09	3.74E-17	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	9.89E-08	NA	mr1536	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	6.25E-08	2.65E-14	mr1536	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	2.19E-08	3.00E-13	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	1.82E-06	1.26E-08	mr1004_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	1.08E-15	4.27E-19	mr1006_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	1.66E-12	1.14E-18	mr1006_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	8.82E-06	NA	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	NA	5.29E-06	mr1010_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	4.99E-12	NA	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	2.45E-10	6.79E-14	mr1051_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	1.13E-10	NA	mr1536_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	1.06E-10	8.87E-18	mr1536_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	1.43E-06	NA	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	4.67E-08	1.67E-13	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921462199	4.24E-07	1.90E-08	mr1986_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251