Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921459327:

Variant ID: vg0921459327 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 21459327
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, C: 0.22, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

GTAAAACAAAAACAAATTGGGCGTTGATTTTTAGTTAATCCAAATGAATATAGAGATGCGCAATTAACTACTCCCTCCATTCCAAATTGATCTACATATT[C/T]
CATAAGTACACTAAAACCAAGAAAAGTTAATAATTTTCTCATGTTATATTTACTCTAGCAACAAACTCAATGCATGCACCATCCCCAATATTTCCTAGCC

Reverse complement sequence

GGCTAGGAAATATTGGGGATGGTGCATGCATTGAGTTTGTTGCTAGAGTAAATATAACATGAGAAAATTATTAACTTTTCTTGGTTTTAGTGTACTTATG[G/A]
AATATGTAGATCAATTTGGAATGGAGGGAGTAGTTAATTGCGCATCTCTATATTCATTTGGATTAACTAAAAATCAACGCCCAATTTGTTTTTGTTTTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.10%	21.60%	0.11%	0.19%	NA
All Indica	2759	63.80%	35.70%	0.18%	0.29%	NA
All Japonica	1512	99.80%	0.10%	0.00%	0.07%	NA
Aus	269	91.10%	8.90%	0.00%	0.00%	NA
Indica I	595	72.30%	27.40%	0.34%	0.00%	NA
Indica II	465	65.60%	33.30%	0.22%	0.86%	NA
Indica III	913	57.10%	42.60%	0.00%	0.33%	NA
Indica Intermediate	786	64.10%	35.50%	0.25%	0.13%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0921459327	C -> DEL	N	N	silent_mutation	Average:50.124; most accessible tissue: Zhenshan97 root, score: 86.991	N	N	N	N
vg0921459327	C -> T	LOC_Os09g37200.1	upstream_gene_variant ; 4292.0bp to feature; MODIFIER	silent_mutation	Average:50.124; most accessible tissue: Zhenshan97 root, score: 86.991	N	N	N	N
vg0921459327	C -> T	LOC_Os09g37180-LOC_Os09g37200	intergenic_region ; MODIFIER	silent_mutation	Average:50.124; most accessible tissue: Zhenshan97 root, score: 86.991	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0921459327	3.36E-07	NA	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	3.40E-06	7.24E-09	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	8.34E-06	6.41E-09	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	NA	6.87E-08	mr1004	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	5.13E-11	1.53E-15	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	4.79E-09	6.19E-16	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	7.92E-10	8.51E-15	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	1.48E-08	3.85E-15	mr1007	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	NA	9.60E-07	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	1.78E-07	NA	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	1.02E-06	2.87E-10	mr1051	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	5.46E-11	7.51E-16	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	4.84E-09	2.90E-16	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	4.79E-07	NA	mr1536	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	6.02E-07	6.98E-13	mr1536	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	1.38E-08	2.43E-13	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	1.04E-06	1.06E-08	mr1004_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	2.07E-15	7.78E-19	mr1006_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	3.25E-12	2.33E-18	mr1006_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	5.85E-06	NA	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	NA	3.41E-06	mr1010_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	1.96E-12	NA	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	8.69E-11	2.02E-14	mr1051_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	1.21E-10	NA	mr1536_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	2.69E-10	7.40E-17	mr1536_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	2.25E-06	NA	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	1.49E-07	9.68E-13	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921459327	1.34E-06	8.86E-08	mr1986_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251