\
| Variant ID: vg0921456056 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 21456056 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 250. )
CTAGGGTACATGACTGGGCACCGACGAGGCAAAAGTCACCCGCTTCACCAAATTCTCTCCGCACTCCGACGTGGTGGTGGTGTACTGTGACCGGGTTTTG[G/A]
CGAAACAAAGCTACTTGTTCCACATTCACTATATTCACCGTTAAATCTGCACCAACCTCAACCTTCGGCGAGCAAACAACTTTGAAGACGACGATCATAA
TTATGATCGTCGTCTTCAAAGTTGTTTGCTCGCCGAAGGTTGAGGTTGGTGCAGATTTAACGGTGAATATAGTGAATGTGGAACAAGTAGCTTTGTTTCG[C/T]
CAAAACCCGGTCACAGTACACCACCACCACGTCGGAGTGCGGAGAGAATTTGGTGAAGCGGGTGACTTTTGCCTCGTCGGTGCCCAGTCATGTACCCTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.10% | 10.90% | 1.16% | 1.82% | NA |
| All Indica | 2759 | 77.50% | 17.50% | 1.88% | 3.12% | NA |
| All Japonica | 1512 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.00% | 3.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 78.30% | 17.60% | 1.51% | 2.58% | NA |
| Indica III | 913 | 68.60% | 23.50% | 2.41% | 5.48% | NA |
| Indica Intermediate | 786 | 73.40% | 20.90% | 2.67% | 3.05% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 6.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0921456056 | G -> DEL | N | N | silent_mutation | Average:37.015; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0921456056 | G -> A | LOC_Os09g37180.1 | downstream_gene_variant ; 3408.0bp to feature; MODIFIER | silent_mutation | Average:37.015; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0921456056 | G -> A | LOC_Os09g37180-LOC_Os09g37200 | intergenic_region ; MODIFIER | silent_mutation | Average:37.015; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0921456056 | 1.31E-07 | NA | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 1.65E-06 | 9.12E-06 | mr1003 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 4.97E-06 | 9.50E-09 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | NA | 7.20E-08 | mr1004 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 1.50E-18 | 1.58E-22 | mr1006 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 5.00E-17 | 9.53E-22 | mr1006 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 2.64E-16 | 1.25E-20 | mr1007 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 2.05E-16 | 4.45E-21 | mr1007 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | NA | 1.65E-06 | mr1008 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | NA | 6.89E-07 | mr1009 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 1.19E-07 | NA | mr1037 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 3.38E-08 | 1.19E-11 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 5.38E-08 | NA | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 4.10E-07 | 5.95E-07 | mr1051 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 1.92E-19 | 7.04E-24 | mr1052 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 4.30E-18 | 3.78E-23 | mr1052 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | NA | 8.51E-07 | mr1536 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 2.55E-06 | NA | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 1.42E-09 | 1.62E-15 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 9.93E-08 | 3.77E-11 | mr1004_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 6.27E-22 | 7.08E-26 | mr1006_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 1.12E-18 | 7.91E-24 | mr1006_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | NA | 3.07E-08 | mr1008_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | NA | 4.15E-08 | mr1037_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 1.31E-11 | NA | mr1051_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 7.49E-10 | 2.15E-10 | mr1051_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 4.69E-06 | NA | mr1536_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 7.79E-06 | 2.19E-08 | mr1536_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 5.01E-09 | NA | mr1870_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 4.16E-08 | 5.13E-07 | mr1870_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 3.80E-14 | 2.81E-20 | mr1986_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921456056 | 9.16E-13 | 2.37E-14 | mr1986_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |