RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0921456056:

Variant ID: vg0921456056 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 21456056
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

CTAGGGTACATGACTGGGCACCGACGAGGCAAAAGTCACCCGCTTCACCAAATTCTCTCCGCACTCCGACGTGGTGGTGGTGTACTGTGACCGGGTTTTG[G/A]
CGAAACAAAGCTACTTGTTCCACATTCACTATATTCACCGTTAAATCTGCACCAACCTCAACCTTCGGCGAGCAAACAACTTTGAAGACGACGATCATAA

Reverse complement sequence

TTATGATCGTCGTCTTCAAAGTTGTTTGCTCGCCGAAGGTTGAGGTTGGTGCAGATTTAACGGTGAATATAGTGAATGTGGAACAAGTAGCTTTGTTTCG[C/T]
CAAAACCCGGTCACAGTACACCACCACCACGTCGGAGTGCGGAGAGAATTTGGTGAAGCGGGTGACTTTTGCCTCGTCGGTGCCCAGTCATGTACCCTAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.10%	10.90%	1.16%	1.82%	NA
All Indica	2759	77.50%	17.50%	1.88%	3.12%	NA
All Japonica	1512	99.60%	0.30%	0.13%	0.00%	NA
Aus	269	91.10%	8.90%	0.00%	0.00%	NA
Indica I	595	96.00%	3.70%	0.34%	0.00%	NA
Indica II	465	78.30%	17.60%	1.51%	2.58%	NA
Indica III	913	68.60%	23.50%	2.41%	5.48%	NA
Indica Intermediate	786	73.40%	20.90%	2.67%	3.05%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.20%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	6.70%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0921456056	G -> DEL	N	N	silent_mutation	Average:37.015; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0921456056	G -> A	LOC_Os09g37180.1	downstream_gene_variant ; 3408.0bp to feature; MODIFIER	silent_mutation	Average:37.015; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0921456056	G -> A	LOC_Os09g37180-LOC_Os09g37200	intergenic_region ; MODIFIER	silent_mutation	Average:37.015; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0921456056	1.31E-07	NA	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056	1.65E-06	9.12E-06	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056	4.97E-06	9.50E-09	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056	NA	7.20E-08	mr1004	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056	1.50E-18	1.58E-22	mr1006	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056	5.00E-17	9.53E-22	mr1006	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056	2.64E-16	1.25E-20	mr1007	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056	2.05E-16	4.45E-21	mr1007	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056	NA	1.65E-06	mr1008	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056	NA	6.89E-07	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 32 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg0921456056:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact