\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921456056:

Variant ID: vg0921456056 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21456056
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGGGTACATGACTGGGCACCGACGAGGCAAAAGTCACCCGCTTCACCAAATTCTCTCCGCACTCCGACGTGGTGGTGGTGTACTGTGACCGGGTTTTG[G/A]
CGAAACAAAGCTACTTGTTCCACATTCACTATATTCACCGTTAAATCTGCACCAACCTCAACCTTCGGCGAGCAAACAACTTTGAAGACGACGATCATAA

Reverse complement sequence

TTATGATCGTCGTCTTCAAAGTTGTTTGCTCGCCGAAGGTTGAGGTTGGTGCAGATTTAACGGTGAATATAGTGAATGTGGAACAAGTAGCTTTGTTTCG[C/T]
CAAAACCCGGTCACAGTACACCACCACCACGTCGGAGTGCGGAGAGAATTTGGTGAAGCGGGTGACTTTTGCCTCGTCGGTGCCCAGTCATGTACCCTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.10% 10.90% 1.16% 1.82% NA
All Indica  2759 77.50% 17.50% 1.88% 3.12% NA
All Japonica  1512 99.60% 0.30% 0.13% 0.00% NA
Aus  269 91.10% 8.90% 0.00% 0.00% NA
Indica I  595 96.00% 3.70% 0.34% 0.00% NA
Indica II  465 78.30% 17.60% 1.51% 2.58% NA
Indica III  913 68.60% 23.50% 2.41% 5.48% NA
Indica Intermediate  786 73.40% 20.90% 2.67% 3.05% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921456056 G -> DEL N N silent_mutation Average:37.015; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0921456056 G -> A LOC_Os09g37180.1 downstream_gene_variant ; 3408.0bp to feature; MODIFIER silent_mutation Average:37.015; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0921456056 G -> A LOC_Os09g37180-LOC_Os09g37200 intergenic_region ; MODIFIER silent_mutation Average:37.015; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921456056 1.31E-07 NA mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 1.65E-06 9.12E-06 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 4.97E-06 9.50E-09 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 NA 7.20E-08 mr1004 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 1.50E-18 1.58E-22 mr1006 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 5.00E-17 9.53E-22 mr1006 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 2.64E-16 1.25E-20 mr1007 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 2.05E-16 4.45E-21 mr1007 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 NA 1.65E-06 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 NA 6.89E-07 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 1.19E-07 NA mr1037 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 3.38E-08 1.19E-11 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 5.38E-08 NA mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 4.10E-07 5.95E-07 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 1.92E-19 7.04E-24 mr1052 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 4.30E-18 3.78E-23 mr1052 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 NA 8.51E-07 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 2.55E-06 NA mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 1.42E-09 1.62E-15 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 9.93E-08 3.77E-11 mr1004_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 6.27E-22 7.08E-26 mr1006_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 1.12E-18 7.91E-24 mr1006_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 NA 3.07E-08 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 NA 4.15E-08 mr1037_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 1.31E-11 NA mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 7.49E-10 2.15E-10 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 4.69E-06 NA mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 7.79E-06 2.19E-08 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 5.01E-09 NA mr1870_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 4.16E-08 5.13E-07 mr1870_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 3.80E-14 2.81E-20 mr1986_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456056 9.16E-13 2.37E-14 mr1986_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251