Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921456034:

Variant ID: vg0921456034 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 21456034
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.54, A: 0.46, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAATCCATGTTTGATGAAGGCTAGGGTACATGACTGGGCACCGACGAGGCAAAAGTCACCCGCTTCACCAAATTCTCTCCGCACTCCGACGTGGTGGT[G/A]
GTGTACTGTGACCGGGTTTTGGCGAAACAAAGCTACTTGTTCCACATTCACTATATTCACCGTTAAATCTGCACCAACCTCAACCTTCGGCGAGCAAACA

Reverse complement sequence

TGTTTGCTCGCCGAAGGTTGAGGTTGGTGCAGATTTAACGGTGAATATAGTGAATGTGGAACAAGTAGCTTTGTTTCGCCAAAACCCGGTCACAGTACAC[C/T]
ACCACCACGTCGGAGTGCGGAGAGAATTTGGTGAAGCGGGTGACTTTTGCCTCGTCGGTGCCCAGTCATGTACCCTAGCCTTCATCAAACATGGATTTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.10%	23.00%	5.61%	38.28%	NA
All Indica	2759	2.40%	38.10%	7.72%	51.79%	NA
All Japonica	1512	79.20%	0.10%	1.98%	18.65%	NA
Aus	269	85.10%	8.90%	4.83%	1.12%	NA
Indica I	595	1.30%	27.60%	5.04%	66.05%	NA
Indica II	465	4.10%	34.00%	11.61%	50.32%	NA
Indica III	913	1.10%	48.40%	7.12%	43.37%	NA
Indica Intermediate	786	3.70%	36.50%	8.14%	51.65%	NA
Temperate Japonica	767	94.80%	0.10%	1.69%	3.39%	NA
Tropical Japonica	504	49.60%	0.00%	2.98%	47.42%	NA
Japonica Intermediate	241	91.70%	0.40%	0.83%	7.05%	NA
VI/Aromatic	96	26.00%	0.00%	1.04%	72.92%	NA
Intermediate	90	50.00%	13.30%	8.89%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0921456034	G -> DEL	N	N	silent_mutation	Average:37.557; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0921456034	G -> A	LOC_Os09g37180.1	downstream_gene_variant ; 3386.0bp to feature; MODIFIER	silent_mutation	Average:37.557; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0921456034	G -> A	LOC_Os09g37180-LOC_Os09g37200	intergenic_region ; MODIFIER	silent_mutation	Average:37.557; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0921456034	NA	5.71E-07	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	NA	4.64E-07	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	NA	6.29E-06	mr1004	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	4.65E-10	2.86E-14	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	6.22E-08	2.10E-14	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	3.71E-09	7.33E-14	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	1.31E-07	1.05E-13	mr1007	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	NA	4.70E-06	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	3.46E-06	NA	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	NA	1.74E-08	mr1051	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	4.97E-10	1.57E-14	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	5.35E-08	9.47E-15	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	9.14E-07	NA	mr1536	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	1.55E-06	2.72E-12	mr1536	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	4.54E-08	3.89E-13	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	3.53E-06	2.67E-08	mr1004_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	1.39E-15	1.65E-18	mr1006_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	1.12E-11	3.82E-17	mr1006_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	1.68E-06	NA	mr1010_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	NA	8.89E-06	mr1010_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	3.53E-12	NA	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	8.88E-10	5.85E-13	mr1051_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	1.25E-10	NA	mr1536_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	1.26E-10	2.79E-17	mr1536_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	NA	7.86E-06	mr1746_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	1.99E-06	NA	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	6.33E-08	1.22E-13	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921456034	4.07E-06	1.87E-07	mr1986_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251