\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921455943:

Variant ID: vg0921455943 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21455943
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TACAAGGACAGGTCACTATACTATAAACACATTTAAAATGGACGGGAACCGGATACACCGTTGCTGGGCACCAACGAGGCAAAAGCAACCATAAAATCCA[T/C]
GTTTGATGAAGGCTAGGGTACATGACTGGGCACCGACGAGGCAAAAGTCACCCGCTTCACCAAATTCTCTCCGCACTCCGACGTGGTGGTGGTGTACTGT

Reverse complement sequence

ACAGTACACCACCACCACGTCGGAGTGCGGAGAGAATTTGGTGAAGCGGGTGACTTTTGCCTCGTCGGTGCCCAGTCATGTACCCTAGCCTTCATCAAAC[A/G]
TGGATTTTATGGTTGCTTTTGCCTCGTTGGTGCCCAGCAACGGTGTATCCGGTTCCCGTCCATTTTAAATGTGTTTATAGTATAGTGACCTGTCCTTGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.30% 13.90% 6.71% 36.08% NA
All Indica  2759 20.20% 22.60% 8.88% 48.28% NA
All Japonica  1512 78.20% 0.10% 2.71% 19.05% NA
Aus  269 85.10% 8.90% 5.20% 0.74% NA
Indica I  595 26.60% 4.20% 12.44% 56.81% NA
Indica II  465 17.40% 21.70% 5.81% 55.05% NA
Indica III  913 20.60% 31.50% 7.78% 40.09% NA
Indica Intermediate  786 16.70% 26.70% 9.29% 47.33% NA
Temperate Japonica  767 93.50% 0.10% 2.87% 3.52% NA
Tropical Japonica  504 48.20% 0.00% 3.37% 48.41% NA
Japonica Intermediate  241 92.10% 0.00% 0.83% 7.05% NA
VI/Aromatic  96 25.00% 0.00% 11.46% 63.54% NA
Intermediate  90 61.10% 7.80% 6.67% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921455943 T -> DEL N N silent_mutation Average:39.882; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0921455943 T -> C LOC_Os09g37180.1 downstream_gene_variant ; 3295.0bp to feature; MODIFIER silent_mutation Average:39.882; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0921455943 T -> C LOC_Os09g37180-LOC_Os09g37200 intergenic_region ; MODIFIER silent_mutation Average:39.882; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921455943 5.22E-07 NA mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 2.10E-06 9.70E-06 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 2.04E-06 7.23E-09 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 NA 2.30E-07 mr1004 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 1.01E-16 7.98E-22 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 7.37E-16 3.04E-21 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 1.46E-14 6.58E-20 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 2.73E-15 1.42E-20 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 NA 1.16E-06 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 NA 1.10E-06 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 1.10E-06 NA mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 2.07E-07 2.93E-11 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 4.13E-07 NA mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 6.14E-07 6.34E-07 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 4.51E-17 8.04E-23 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 3.19E-16 3.76E-22 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 NA 3.85E-07 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 3.01E-11 4.00E-17 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 2.87E-08 6.92E-12 mr1004_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 4.16E-20 8.54E-25 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 4.38E-17 6.39E-23 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 6.45E-07 NA mr1008_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 NA 8.83E-09 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 NA 5.13E-08 mr1037_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 3.58E-10 NA mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 1.58E-09 1.71E-10 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 NA 4.00E-08 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 9.58E-08 NA mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 1.47E-06 2.06E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 1.39E-12 1.03E-18 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921455943 6.76E-11 4.81E-13 mr1986_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251