Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921454415:

Variant ID: vg0921454415 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 21454415
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CACATGCACCCACAAATATTTTAGTAGGAGCTCAATTCTGATTAGGCAAAAGGAGATTAAAAACTTCTCGGTGACTTGCCGGCGGCTCGCAAGCAGGCGC[G/C]
CCGTGCAGTGGAGATTAAACATTCCCCCGTCGAGCTGATGTCGCAGGCGGAGATGATCGTGCTAGGCGGTGAGTACGATGAATAATTTCCTCCAATCCTG

Reverse complement sequence

CAGGATTGGAGGAAATTATTCATCGTACTCACCGCCTAGCACGATCATCTCCGCCTGCGACATCAGCTCGACGGGGGAATGTTTAATCTCCACTGCACGG[C/G]
GCGCCTGCTTGCGAGCCGCCGGCAAGTCACCGAGAAGTTTTTAATCTCCTTTTGCCTAATCAGAATTGAGCTCCTACTAAAATATTTGTGGGTGCATGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.30%	9.30%	0.59%	3.75%	NA
All Indica	2759	77.70%	15.00%	1.01%	6.27%	NA
All Japonica	1512	99.90%	0.00%	0.00%	0.07%	NA
Aus	269	91.10%	8.20%	0.00%	0.74%	NA
Indica I	595	96.00%	2.90%	0.34%	0.84%	NA
Indica II	465	78.90%	13.80%	1.29%	6.02%	NA
Indica III	913	68.50%	20.40%	0.88%	10.30%	NA
Indica Intermediate	786	73.90%	18.70%	1.53%	5.85%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	5.60%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0921454415	G -> DEL	N	N	silent_mutation	Average:62.791; most accessible tissue: Zhenshan97 root, score: 82.733	N	N	N	N
vg0921454415	G -> C	LOC_Os09g37180.1	downstream_gene_variant ; 1767.0bp to feature; MODIFIER	silent_mutation	Average:62.791; most accessible tissue: Zhenshan97 root, score: 82.733	N	N	N	N
vg0921454415	G -> C	LOC_Os09g37180-LOC_Os09g37200	intergenic_region ; MODIFIER	silent_mutation	Average:62.791; most accessible tissue: Zhenshan97 root, score: 82.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0921454415	1.66E-07	NA	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	1.53E-06	5.30E-06	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	2.34E-06	1.22E-08	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	NA	1.64E-07	mr1004	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	6.64E-18	4.02E-21	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	1.09E-16	2.25E-22	mr1006	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	2.79E-15	6.37E-19	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	9.83E-16	2.86E-21	mr1007	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	NA	2.76E-06	mr1008	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	NA	1.88E-06	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	8.46E-08	NA	mr1037	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	9.01E-08	1.57E-11	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	1.60E-08	NA	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	1.84E-07	2.31E-07	mr1051	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	2.90E-18	5.99E-22	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	5.45E-17	2.55E-23	mr1052	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	6.82E-06	1.37E-07	mr1536	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	NA	6.13E-06	mr1986	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	5.19E-09	1.18E-14	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	8.89E-07	1.62E-10	mr1004_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	1.76E-20	6.99E-25	mr1006_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	5.88E-16	7.24E-23	mr1006_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	NA	2.28E-08	mr1008_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	NA	1.70E-07	mr1037_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	1.01E-11	NA	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	2.77E-09	2.36E-10	mr1051_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	2.09E-06	NA	mr1536_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	9.35E-06	2.82E-08	mr1536_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	2.19E-06	NA	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	1.08E-12	8.48E-19	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921454415	8.91E-11	6.95E-13	mr1986_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251