\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921431410:

Variant ID: vg0921431410 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21431410
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGCTTTCAGTGTCTTGTGTTCTTATATTCTTATTGTAAATTCTTTTTGGTTTTCTTTTGGTAGCTTGAAAGCTCATCTTGCTTTTATCATTTGGTTTT[G/T]
TCATAGGTTTGGAATGGGTTTTTCTTTTTCTATAGACATAAGGATCTTGAAAACCAAACTGATAGCAAAAATCTCCCATTTCTCTTTTACCAAGAATCCT

Reverse complement sequence

AGGATTCTTGGTAAAAGAGAAATGGGAGATTTTTGCTATCAGTTTGGTTTTCAAGATCCTTATGTCTATAGAAAAAGAAAAACCCATTCCAAACCTATGA[C/A]
AAAACCAAATGATAAAAGCAAGATGAGCTTTCAAGCTACCAAAAGAAAACCAAAAAGAATTTACAATAAGAATATAAGAACACAAGACACTGAAAGCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.50% 36.60% 3.51% 20.29% NA
All Indica  2759 5.90% 55.30% 5.58% 33.20% NA
All Japonica  1512 93.00% 6.80% 0.13% 0.07% NA
Aus  269 84.40% 1.10% 1.49% 13.01% NA
Indica I  595 1.20% 85.00% 1.34% 12.44% NA
Indica II  465 6.20% 61.50% 4.73% 27.53% NA
Indica III  913 7.90% 31.40% 9.20% 51.48% NA
Indica Intermediate  786 6.90% 57.00% 5.09% 31.04% NA
Temperate Japonica  767 99.20% 0.50% 0.26% 0.00% NA
Tropical Japonica  504 81.30% 18.70% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.10% 0.00% 0.41% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 56.70% 28.90% 6.67% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921431410 G -> DEL N N silent_mutation Average:11.074; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0921431410 G -> T LOC_Os09g37160.1 upstream_gene_variant ; 2479.0bp to feature; MODIFIER silent_mutation Average:11.074; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0921431410 G -> T LOC_Os09g37150.1 intron_variant ; MODIFIER silent_mutation Average:11.074; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921431410 5.65E-08 4.87E-22 mr1003 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 2.58E-07 5.90E-07 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 NA 3.62E-07 mr1004 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 NA 8.98E-08 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 NA 2.37E-09 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 NA 7.36E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 NA 7.52E-09 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 9.09E-08 2.71E-23 mr1051 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 2.46E-07 6.32E-08 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 5.09E-06 4.41E-08 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 NA 1.14E-09 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 NA 3.72E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 7.21E-07 1.54E-09 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 NA 2.60E-10 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 4.36E-06 NA mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 5.80E-06 1.14E-09 mr1004_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 4.72E-09 9.34E-08 mr1006_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 2.48E-07 5.49E-12 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 1.24E-10 6.27E-29 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 1.03E-10 3.79E-12 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 NA 9.50E-06 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 NA 1.94E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 NA 1.29E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 7.75E-06 7.75E-06 mr1448_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 2.34E-06 NA mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 1.03E-08 4.43E-13 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921431410 NA 7.44E-18 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251