\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921393671:

Variant ID: vg0921393671 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 21393671
Reference Allele: GTAAlternative Allele: G,ATA
Primary Allele: GTASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTCTTCAAGCATTCCTCAGTCATTTGTGTTCTTTCACCTCGGTATGCCAGCAGTAAGCTGAGCATTTTCAAACAACAGGCAAGTGCCAGGCTGGATA[GTA/G,ATA]
TATAGCTGATAACTGTTAGCACTTTTATACGTTCCAGATAATGGTTATCACCATAAACCTTAAGGAAGTTTATTGTTTGCTCATGTGTGCTGCCCCTTCT

Reverse complement sequence

AGAAGGGGCAGCACACATGAGCAAACAATAAACTTCCTTAAGGTTTATGGTGATAACCATTATCTGGAACGTATAAAAGTGCTAACAGTTATCAGCTATA[TAC/C,TAT]
TATCCAGCCTGGCACTTGCCTGTTGTTTGAAAATGCTCAGCTTACTGCTGGCATACCGAGGTGAAAGAACACAAATGACTGAGGAATGCTTGAAGAATTT

Allele Frequencies:

Populations Population SizeFrequency of GTA(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 26.50% 1.21% 0.11% ATA: 18.05%
All Indica  2759 54.60% 43.40% 0.72% 0.18% ATA: 1.12%
All Japonica  1512 60.80% 0.10% 2.12% 0.00% ATA: 37.04%
Aus  269 1.10% 15.60% 0.00% 0.00% ATA: 83.27%
Indica I  595 77.00% 22.00% 0.84% 0.17% NA
Indica II  465 63.90% 34.40% 0.65% 0.43% ATA: 0.65%
Indica III  913 31.10% 66.90% 0.55% 0.22% ATA: 1.20%
Indica Intermediate  786 59.40% 37.50% 0.89% 0.00% ATA: 2.16%
Temperate Japonica  767 92.30% 0.00% 1.17% 0.00% ATA: 6.52%
Tropical Japonica  504 26.00% 0.00% 2.18% 0.00% ATA: 71.83%
Japonica Intermediate  241 33.20% 0.40% 4.98% 0.00% ATA: 61.41%
VI/Aromatic  96 78.10% 1.00% 3.12% 0.00% ATA: 17.71%
Intermediate  90 61.10% 13.30% 2.22% 0.00% ATA: 23.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921393671 GTA -> G LOC_Os09g37090.1 downstream_gene_variant ; 3145.0bp to feature; MODIFIER silent_mutation Average:71.017; most accessible tissue: Zhenshan97 root, score: 85.556 N N N N
vg0921393671 GTA -> G LOC_Os09g37100.1 intron_variant ; MODIFIER silent_mutation Average:71.017; most accessible tissue: Zhenshan97 root, score: 85.556 N N N N
vg0921393671 GTA -> DEL N N silent_mutation Average:71.017; most accessible tissue: Zhenshan97 root, score: 85.556 N N N N
vg0921393671 GTA -> ATA LOC_Os09g37090.1 downstream_gene_variant ; 3144.0bp to feature; MODIFIER silent_mutation Average:71.017; most accessible tissue: Zhenshan97 root, score: 85.556 N N N N
vg0921393671 GTA -> ATA LOC_Os09g37100.1 intron_variant ; MODIFIER silent_mutation Average:71.017; most accessible tissue: Zhenshan97 root, score: 85.556 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0921393671 GTA ATA -0.05 -0.03 -0.04 -0.07 -0.07 -0.03
vg0921393671 GTA G -0.15 0.03 0.16 -0.01 0.02 0.14

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921393671 NA 3.79E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 7.58E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 5.36E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 6.17E-08 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 2.96E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 9.87E-06 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 2.51E-06 NA mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 2.10E-15 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 1.22E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 1.33E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 1.77E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 9.18E-06 9.17E-06 mr1474_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 9.18E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 4.41E-20 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 1.98E-16 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 6.58E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 8.26E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 6.92E-08 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 2.66E-15 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 5.85E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 4.93E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921393671 NA 3.29E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251