\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921372623:

Variant ID: vg0921372623 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 21372623
Reference Allele: AAlternative Allele: G,ATT
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTGGATGTCCACCCGTTTATGATATATGTCATCTAAATAGTTATAAAAAAATTTAGTTGACATATAATAAACGAGTGGATGTCCACTCGAGTGATTAA[A/G,ATT]
ATCCATCTCCCGCAGATCACTCCAAGCTGGTTGGCGCCTGCCTGCCAACCACTAATTAACATTCAGATCGCCAGGCTAGCTCAAGAATTCAGTCTTACTC

Reverse complement sequence

GAGTAAGACTGAATTCTTGAGCTAGCCTGGCGATCTGAATGTTAATTAGTGGTTGGCAGGCAGGCGCCAACCAGCTTGGAGTGATCTGCGGGAGATGGAT[T/C,AAT]
TTAATCACTCGAGTGGACATCCACTCGTTTATTATATGTCAACTAAATTTTTTTATAACTATTTAGATGACATATATCATAAACGGGTGGACATCCACCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.30% 16.40% 2.35% 7.91% ATT: 0.04%
All Indica  2759 56.20% 26.90% 3.55% 13.34% NA
All Japonica  1512 99.90% 0.00% 0.00% 0.13% NA
Aus  269 85.50% 8.90% 4.46% 1.12% NA
Indica I  595 64.90% 10.90% 3.70% 20.50% NA
Indica II  465 56.30% 32.90% 1.29% 9.46% NA
Indica III  913 49.30% 35.40% 3.29% 12.05% NA
Indica Intermediate  786 57.60% 25.60% 5.09% 11.70% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 10.00% 1.11% 1.11% ATT: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921372623 A -> G LOC_Os09g37050.1 upstream_gene_variant ; 247.0bp to feature; MODIFIER silent_mutation Average:77.423; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0921372623 A -> G LOC_Os09g37040.1 downstream_gene_variant ; 2230.0bp to feature; MODIFIER silent_mutation Average:77.423; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0921372623 A -> G LOC_Os09g37060.1 downstream_gene_variant ; 3190.0bp to feature; MODIFIER silent_mutation Average:77.423; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0921372623 A -> G LOC_Os09g37050-LOC_Os09g37060 intergenic_region ; MODIFIER silent_mutation Average:77.423; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0921372623 A -> DEL N N silent_mutation Average:77.423; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0921372623 A -> ATT LOC_Os09g37050.1 upstream_gene_variant ; 248.0bp to feature; MODIFIER silent_mutation Average:77.423; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0921372623 A -> ATT LOC_Os09g37040.1 downstream_gene_variant ; 2231.0bp to feature; MODIFIER silent_mutation Average:77.423; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0921372623 A -> ATT LOC_Os09g37060.1 downstream_gene_variant ; 3189.0bp to feature; MODIFIER silent_mutation Average:77.423; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0921372623 A -> ATT LOC_Os09g37050-LOC_Os09g37060 intergenic_region ; MODIFIER silent_mutation Average:77.423; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0921372623 A ATT 0.05 -0.15 -0.08 0.12 0.0 0.0
vg0921372623 A G -0.11 0.03 0.02 0.01 0.04 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921372623 NA 2.99E-10 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921372623 NA 1.07E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921372623 NA 7.98E-11 mr1527_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921372623 NA 1.63E-06 mr1527_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251