\
| Variant ID: vg0921282690 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 21282690 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.32, others allele: 0.00, population size: 113. )
TTATATTTAGTCTATTATATTGACAATTAACATATTTTGTTATTAATTAAACTAATTTATTCACCCCTATCTAGTGGTGAAAACGGTACGGAAACGGACG[G/A]
AAACCATCTTTATCGTTTTCGTTTTCATTTTTTTTTTGGAATCAGAATCGGAATCGGAAACTCTGGATACGAAAACGGAATCGAATATTATCGAAATGAA
TTCATTTCGATAATATTCGATTCCGTTTTCGTATCCAGAGTTTCCGATTCCGATTCTGATTCCAAAAAAAAAATGAAAACGAAAACGATAAAGATGGTTT[C/T]
CGTCCGTTTCCGTACCGTTTTCACCACTAGATAGGGGTGAATAAATTAGTTTAATTAATAACAAAATATGTTAATTGTCAATATAATAGACTAAATATAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.80% | 44.60% | 0.17% | 0.42% | NA |
| All Indica | 2759 | 29.20% | 69.90% | 0.22% | 0.72% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 40.50% | 59.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 5.00% | 93.80% | 0.34% | 0.84% | NA |
| Indica II | 465 | 31.80% | 66.90% | 0.00% | 1.29% | NA |
| Indica III | 913 | 43.70% | 55.80% | 0.11% | 0.44% | NA |
| Indica Intermediate | 786 | 29.00% | 70.00% | 0.38% | 0.64% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 18.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0921282690 | G -> DEL | N | N | silent_mutation | Average:30.145; most accessible tissue: Callus, score: 60.147 | N | N | N | N |
| vg0921282690 | G -> A | LOC_Os09g36900.1 | downstream_gene_variant ; 2070.0bp to feature; MODIFIER | silent_mutation | Average:30.145; most accessible tissue: Callus, score: 60.147 | N | N | N | N |
| vg0921282690 | G -> A | LOC_Os09g36900-LOC_Os09g36910 | intergenic_region ; MODIFIER | silent_mutation | Average:30.145; most accessible tissue: Callus, score: 60.147 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0921282690 | 3.00E-06 | NA | mr1006 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921282690 | 7.71E-06 | 3.11E-06 | mr1007 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921282690 | 4.99E-06 | 5.53E-06 | mr1052 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921282690 | NA | 3.57E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921282690 | NA | 8.04E-06 | mr1006_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |