Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921250310:

Variant ID: vg0921250310 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 21250310
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

GTAATTCGTCAAAAAAAATTATGACACCGTAGCGTTAGCACGGGCAAATTAACTGGTAGAATATGTTCAAGTGTACGCTTCTCTTGAGCCACGTGTCATC[G/A]
TGTGAAATTGCGACCGCCTATCTAGCATCATCGCAATGGGAGCCTTAACTTCATCGTCACTTGTTTTGTAGAAGATGTCTGATTTTCTTTCAGGTAATTT

Reverse complement sequence

AAATTACCTGAAAGAAAATCAGACATCTTCTACAAAACAAGTGACGATGAAGTTAAGGCTCCCATTGCGATGATGCTAGATAGGCGGTCGCAATTTCACA[C/T]
GATGACACGTGGCTCAAGAGAAGCGTACACTTGAACATATTCTACCAGTTAATTTGCCCGTGCTAACGCTACGGTGTCATAATTTTTTTTGACGAATTAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.10%	42.50%	0.40%	0.02%	NA
All Indica	2759	31.90%	67.50%	0.65%	0.04%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	53.20%	46.80%	0.00%	0.00%	NA
Indica I	595	6.20%	92.90%	0.67%	0.17%	NA
Indica II	465	31.80%	67.10%	1.08%	0.00%	NA
Indica III	913	46.70%	52.90%	0.44%	0.00%	NA
Indica Intermediate	786	34.10%	65.30%	0.64%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	21.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0921250310	G -> DEL	N	N	silent_mutation	Average:32.209; most accessible tissue: Callus, score: 79.247	N	N	N	N
vg0921250310	G -> A	LOC_Os09g36830.1	upstream_gene_variant ; 4482.0bp to feature; MODIFIER	silent_mutation	Average:32.209; most accessible tissue: Callus, score: 79.247	N	N	N	N
vg0921250310	G -> A	LOC_Os09g36840.1	downstream_gene_variant ; 3732.0bp to feature; MODIFIER	silent_mutation	Average:32.209; most accessible tissue: Callus, score: 79.247	N	N	N	N
vg0921250310	G -> A	LOC_Os09g36850.1	downstream_gene_variant ; 1532.0bp to feature; MODIFIER	silent_mutation	Average:32.209; most accessible tissue: Callus, score: 79.247	N	N	N	N
vg0921250310	G -> A	LOC_Os09g36860.1	downstream_gene_variant ; 3948.0bp to feature; MODIFIER	silent_mutation	Average:32.209; most accessible tissue: Callus, score: 79.247	N	N	N	N
vg0921250310	G -> A	LOC_Os09g36840-LOC_Os09g36850	intergenic_region ; MODIFIER	silent_mutation	Average:32.209; most accessible tissue: Callus, score: 79.247	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0921250310	3.45E-06	5.69E-06	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921250310	NA	3.64E-06	mr1007	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921250310	2.12E-06	1.60E-06	mr1052	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921250310	NA	2.03E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921250310	NA	3.36E-06	mr1553_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251