\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921250310:

Variant ID: vg0921250310 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 21250310
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


GTAATTCGTCAAAAAAAATTATGACACCGTAGCGTTAGCACGGGCAAATTAACTGGTAGAATATGTTCAAGTGTACGCTTCTCTTGAGCCACGTGTCATC[G/A]
TGTGAAATTGCGACCGCCTATCTAGCATCATCGCAATGGGAGCCTTAACTTCATCGTCACTTGTTTTGTAGAAGATGTCTGATTTTCTTTCAGGTAATTT

Reverse complement sequence

AAATTACCTGAAAGAAAATCAGACATCTTCTACAAAACAAGTGACGATGAAGTTAAGGCTCCCATTGCGATGATGCTAGATAGGCGGTCGCAATTTCACA[C/T]
GATGACACGTGGCTCAAGAGAAGCGTACACTTGAACATATTCTACCAGTTAATTTGCCCGTGCTAACGCTACGGTGTCATAATTTTTTTTGACGAATTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.10% 42.50% 0.40% 0.02% NA
All Indica  2759 31.90% 67.50% 0.65% 0.04% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 53.20% 46.80% 0.00% 0.00% NA
Indica I  595 6.20% 92.90% 0.67% 0.17% NA
Indica II  465 31.80% 67.10% 1.08% 0.00% NA
Indica III  913 46.70% 52.90% 0.44% 0.00% NA
Indica Intermediate  786 34.10% 65.30% 0.64% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 77.80% 21.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0921250310 G -> DEL N N silent_mutation Average:32.209; most accessible tissue: Callus, score: 79.247 N N N N
vg0921250310 G -> A LOC_Os09g36830.1 upstream_gene_variant ; 4482.0bp to feature; MODIFIER silent_mutation Average:32.209; most accessible tissue: Callus, score: 79.247 N N N N
vg0921250310 G -> A LOC_Os09g36840.1 downstream_gene_variant ; 3732.0bp to feature; MODIFIER silent_mutation Average:32.209; most accessible tissue: Callus, score: 79.247 N N N N
vg0921250310 G -> A LOC_Os09g36850.1 downstream_gene_variant ; 1532.0bp to feature; MODIFIER silent_mutation Average:32.209; most accessible tissue: Callus, score: 79.247 N N N N
vg0921250310 G -> A LOC_Os09g36860.1 downstream_gene_variant ; 3948.0bp to feature; MODIFIER silent_mutation Average:32.209; most accessible tissue: Callus, score: 79.247 N N N N
vg0921250310 G -> A LOC_Os09g36840-LOC_Os09g36850 intergenic_region ; MODIFIER silent_mutation Average:32.209; most accessible tissue: Callus, score: 79.247 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0921250310 3.45E-06 5.69E-06 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921250310 NA 3.64E-06 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921250310 2.12E-06 1.60E-06 mr1052 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921250310 NA 2.03E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921250310 NA 3.36E-06 mr1553_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251