| Variant ID: vg0921250310 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 21250310 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 195. )
GTAATTCGTCAAAAAAAATTATGACACCGTAGCGTTAGCACGGGCAAATTAACTGGTAGAATATGTTCAAGTGTACGCTTCTCTTGAGCCACGTGTCATC[G/A]
TGTGAAATTGCGACCGCCTATCTAGCATCATCGCAATGGGAGCCTTAACTTCATCGTCACTTGTTTTGTAGAAGATGTCTGATTTTCTTTCAGGTAATTT
AAATTACCTGAAAGAAAATCAGACATCTTCTACAAAACAAGTGACGATGAAGTTAAGGCTCCCATTGCGATGATGCTAGATAGGCGGTCGCAATTTCACA[C/T]
GATGACACGTGGCTCAAGAGAAGCGTACACTTGAACATATTCTACCAGTTAATTTGCCCGTGCTAACGCTACGGTGTCATAATTTTTTTTGACGAATTAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.10% | 42.50% | 0.40% | 0.02% | NA |
| All Indica | 2759 | 31.90% | 67.50% | 0.65% | 0.04% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 53.20% | 46.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 6.20% | 92.90% | 0.67% | 0.17% | NA |
| Indica II | 465 | 31.80% | 67.10% | 1.08% | 0.00% | NA |
| Indica III | 913 | 46.70% | 52.90% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 34.10% | 65.30% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 21.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0921250310 | G -> DEL | N | N | silent_mutation | Average:32.209; most accessible tissue: Callus, score: 79.247 | N | N | N | N |
| vg0921250310 | G -> A | LOC_Os09g36830.1 | upstream_gene_variant ; 4482.0bp to feature; MODIFIER | silent_mutation | Average:32.209; most accessible tissue: Callus, score: 79.247 | N | N | N | N |
| vg0921250310 | G -> A | LOC_Os09g36840.1 | downstream_gene_variant ; 3732.0bp to feature; MODIFIER | silent_mutation | Average:32.209; most accessible tissue: Callus, score: 79.247 | N | N | N | N |
| vg0921250310 | G -> A | LOC_Os09g36850.1 | downstream_gene_variant ; 1532.0bp to feature; MODIFIER | silent_mutation | Average:32.209; most accessible tissue: Callus, score: 79.247 | N | N | N | N |
| vg0921250310 | G -> A | LOC_Os09g36860.1 | downstream_gene_variant ; 3948.0bp to feature; MODIFIER | silent_mutation | Average:32.209; most accessible tissue: Callus, score: 79.247 | N | N | N | N |
| vg0921250310 | G -> A | LOC_Os09g36840-LOC_Os09g36850 | intergenic_region ; MODIFIER | silent_mutation | Average:32.209; most accessible tissue: Callus, score: 79.247 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0921250310 | 3.45E-06 | 5.69E-06 | mr1006 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921250310 | NA | 3.64E-06 | mr1007 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921250310 | 2.12E-06 | 1.60E-06 | mr1052 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921250310 | NA | 2.03E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921250310 | NA | 3.36E-06 | mr1553_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |