\
| Variant ID: vg0921118832 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 21118832 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 126. )
TAATGAATGAGATTTCAAAAATTAGAGATGTTAATGCTGCACATGATTTGAAAAATAGACCTTCTCTTGCTTGTAGTTTTGCTCTGCACACACGCACTTT[G/A]
GATGAGTTGTTTTTAACTAAAAAGTTGTTGCAAAAATATCAAATTGCTTTTTATGCTAGTTTGATGTTTAACATGATTTCTGCTAAAAAGTTAAAACAAC
GTTGTTTTAACTTTTTAGCAGAAATCATGTTAAACATCAAACTAGCATAAAAAGCAATTTGATATTTTTGCAACAACTTTTTAGTTAAAAACAACTCATC[C/T]
AAAGTGCGTGTGTGCAGAGCAAAACTACAAGCAAGAGAAGGTCTATTTTTCAAATCATGTGCAGCATTAACATCTCTAATTTTTGAAATCTCATTCATTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 5.40% | 1.80% | 0.00% | NA |
| All Indica | 2759 | 87.90% | 9.10% | 3.01% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.00% | 0.84% | 0.00% | NA |
| Indica II | 465 | 53.80% | 35.50% | 10.75% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.50% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 86.40% | 10.30% | 3.31% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0921118832 | G -> A | LOC_Os09g36610.1 | synonymous_variant ; p.Leu382Leu; LOW | synonymous_codon | Average:15.664; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0921118832 | NA | 6.12E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 6.27E-07 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 1.33E-06 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 2.17E-06 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 1.39E-08 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 9.33E-07 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 5.97E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 1.59E-09 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 9.25E-06 | mr1872 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 2.17E-07 | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 8.53E-08 | mr1887 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 1.71E-08 | mr1887 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 5.93E-06 | mr1958 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 5.23E-07 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 2.19E-06 | mr1976 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 9.17E-06 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 1.68E-10 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0921118832 | NA | 9.30E-10 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |