Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0921095515:

Variant ID: vg0921095515 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 21095515
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

TCGTCGTTCTGTTTCTTCCTTTTGCTTCTGCCTGAAGAAAATCAAATCGTTCTGATCGATCGAACACTCCTCCCCGTTTGCCATTTGCTGTGCAGTGATT[G/A]
ATCAGAGAAAGTAAGTAAACGACTGGAACTAATGGGCGTCAAGTTAGTTGGATGGAATGGATACCTGAAACTCTGCAAGATTGATTGTTACCTTTGTTAA

Reverse complement sequence

TTAACAAAGGTAACAATCAATCTTGCAGAGTTTCAGGTATCCATTCCATCCAACTAACTTGACGCCCATTAGTTCCAGTCGTTTACTTACTTTCTCTGAT[C/T]
AATCACTGCACAGCAAATGGCAAACGGGGAGGAGTGTTCGATCGATCAGAACGATTTGATTTTCTTCAGGCAGAAGCAAAAGGAAGAAACAGAACGACGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.60%	2.20%	0.21%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	92.90%	6.50%	0.60%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	98.30%	1.40%	0.26%	0.00%	NA
Tropical Japonica	504	82.90%	15.90%	1.19%	0.00%	NA
Japonica Intermediate	241	96.70%	2.90%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0921095515	G -> A	LOC_Os09g36580.1	upstream_gene_variant ; 2752.0bp to feature; MODIFIER	silent_mutation	Average:62.359; most accessible tissue: Minghui63 root, score: 85.968	N	N	N	N
vg0921095515	G -> A	LOC_Os09g36560.1	downstream_gene_variant ; 4933.0bp to feature; MODIFIER	silent_mutation	Average:62.359; most accessible tissue: Minghui63 root, score: 85.968	N	N	N	N
vg0921095515	G -> A	LOC_Os09g36560-LOC_Os09g36580	intergenic_region ; MODIFIER	silent_mutation	Average:62.359; most accessible tissue: Minghui63 root, score: 85.968	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0921095515	NA	4.47E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	NA	8.19E-06	mr1817	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	NA	1.37E-06	mr1222_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	NA	1.91E-07	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	9.20E-06	9.20E-06	mr1266_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	4.87E-06	4.87E-06	mr1345_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	1.41E-07	1.41E-07	mr1384_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	4.65E-06	4.65E-06	mr1407_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	1.26E-06	9.43E-08	mr1415_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	3.11E-06	3.11E-06	mr1424_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	1.12E-06	1.12E-06	mr1511_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	NA	2.48E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	5.78E-06	5.78E-06	mr1547_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	8.45E-07	5.59E-09	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	6.49E-06	1.99E-08	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	1.33E-07	1.33E-07	mr1562_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	NA	1.04E-06	mr1575_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	NA	2.26E-07	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	9.77E-06	1.82E-07	mr1849_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	NA	6.03E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	NA	6.57E-07	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	NA	4.01E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	4.09E-07	4.09E-07	mr1934_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0921095515	5.74E-06	1.53E-07	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251