Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920897668:

Variant ID: vg0920897668 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20897668
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, G: 0.04, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTTGCGGGGGAGCCCCACCGGCCCACGGCGCGGGATCACCGCCGCCACAGAAACCTCCATAGAGATCTCCGAGCAGCCGTCCTCCGCCACAACTTTCG[C/G]
CATGGTGGCGCCCTAGCCCCGCGCTTCTTATCCCGCCCCACCTATGGCTGCTGCTGCTGCCGCTGCCGCCGCCACACTCCTCCCATGGCTCTCCTCGCGC

Reverse complement sequence

GCGCGAGGAGAGCCATGGGAGGAGTGTGGCGGCGGCAGCGGCAGCAGCAGCAGCCATAGGTGGGGCGGGATAAGAAGCGCGGGGCTAGGGCGCCACCATG[G/C]
CGAAAGTTGTGGCGGAGGACGGCTGCTCGGAGATCTCTATGGAGGTTTCTGTGGCGGCGGTGATCCCGCGCCGTGGGCCGGTGGGGCTCCCCCGCAACGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 39.70% 0.08% 0.00% NA
All Indica  2759 38.50% 61.40% 0.14% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 38.30% 61.70% 0.00% 0.00% NA
Indica I  595 8.20% 91.60% 0.17% 0.00% NA
Indica II  465 63.70% 36.30% 0.00% 0.00% NA
Indica III  913 41.20% 58.80% 0.00% 0.00% NA
Indica Intermediate  786 43.30% 56.40% 0.38% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920897668 C -> G LOC_Os09g36240.1 5_prime_UTR_variant ; 85.0bp to feature; MODIFIER silent_mutation Average:94.827; most accessible tissue: Minghui63 flag leaf, score: 99.224 N N N N
vg0920897668 C -> G LOC_Os09g36240.2 5_prime_UTR_variant ; 85.0bp to feature; MODIFIER silent_mutation Average:94.827; most accessible tissue: Minghui63 flag leaf, score: 99.224 N N N N
vg0920897668 C -> G LOC_Os09g36240.3 5_prime_UTR_variant ; 85.0bp to feature; MODIFIER silent_mutation Average:94.827; most accessible tissue: Minghui63 flag leaf, score: 99.224 N N N N
vg0920897668 C -> G LOC_Os09g36240.4 5_prime_UTR_variant ; 85.0bp to feature; MODIFIER silent_mutation Average:94.827; most accessible tissue: Minghui63 flag leaf, score: 99.224 N N N N
vg0920897668 C -> G LOC_Os09g36230.1 downstream_gene_variant ; 949.0bp to feature; MODIFIER silent_mutation Average:94.827; most accessible tissue: Minghui63 flag leaf, score: 99.224 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0920897668 C G -0.01 -0.01 0.01 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920897668 NA 5.84E-10 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920897668 NA 1.11E-11 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920897668 NA 1.21E-07 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920897668 NA 1.18E-18 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920897668 NA 1.50E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920897668 NA 7.99E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920897668 NA 5.90E-15 mr1050_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920897668 NA 2.00E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920897668 NA 1.44E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920897668 NA 3.72E-11 mr1272_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920897668 NA 9.91E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920897668 NA 1.56E-07 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920897668 NA 9.16E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920897668 NA 7.18E-09 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920897668 NA 6.02E-15 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920897668 NA 9.89E-07 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920897668 NA 5.59E-07 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251