Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920872974:

Variant ID: vg0920872974 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 20872974
Reference Allele: TAlternative Allele: A,TAA,TA,TAAA,TAAAA
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, T: 0.14, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


GATATTTTACACCCTTAACTATACAAACCGGGTAAATAACCCCCGGCTCAATCCGGGGTGGTTTCAGTACTACGTGGCAGTCCGATCAGCATTTTTTTTT[T/A,TAA,TA,TAAA,TAAAA]
AAAAAACAGTGTGGGCCCCACCTGTAAGACTCTCCGCTCTCTCTTTCACCTCTAACGTCTCAATCTCTCTCTACTCTCTCAATCCCCATCCCCTCTCTTC

Reverse complement sequence

GAAGAGAGGGGATGGGGATTGAGAGAGTAGAGAGAGATTGAGACGTTAGAGGTGAAAGAGAGAGCGGAGAGTCTTACAGGTGGGGCCCACACTGTTTTTT[A/T,TTA,TA,TTTA,TTTTA]
AAAAAAAAATGCTGATCGGACTGCCACGTAGTACTGAAACCACCCCGGATTGAGCCGGGGGTTATTTACCCGGTTTGTATAGTTAAGGGTGTAAAATATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 31.20% 0.83% 0.00% TA: 0.15%; TAA: 0.15%; TAAA: 0.15%; TAAAA: 0.02%
All Indica  2759 79.10% 20.60% 0.22% 0.00% TAA: 0.07%; TA: 0.04%
All Japonica  1512 40.50% 57.50% 1.59% 0.00% TA: 0.40%
Aus  269 94.40% 3.00% 1.49% 0.00% TAA: 1.12%
Indica I  595 92.10% 7.60% 0.00% 0.00% TAA: 0.34%
Indica II  465 95.30% 4.50% 0.22% 0.00% NA
Indica III  913 61.70% 38.30% 0.00% 0.00% NA
Indica Intermediate  786 79.90% 19.30% 0.64% 0.00% TA: 0.13%
Temperate Japonica  767 12.00% 86.20% 1.69% 0.00% TA: 0.13%
Tropical Japonica  504 88.10% 10.10% 0.99% 0.00% TA: 0.79%
Japonica Intermediate  241 31.50% 65.60% 2.49% 0.00% TA: 0.41%
VI/Aromatic  96 88.50% 6.20% 1.04% 0.00% TAAA: 4.17%
Intermediate  90 62.20% 26.70% 4.44% 0.00% TAAA: 3.33%; TAA: 2.22%; TAAAA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920872974 T -> TAA LOC_Os09g36200.1 upstream_gene_variant ; 1867.0bp to feature; MODIFIER silent_mutation Average:86.175; most accessible tissue: Callus, score: 96.111 N N N N
vg0920872974 T -> TAA LOC_Os09g36200-LOC_Os09g36210 intergenic_region ; MODIFIER silent_mutation Average:86.175; most accessible tissue: Callus, score: 96.111 N N N N
vg0920872974 T -> TAAAA LOC_Os09g36200.1 upstream_gene_variant ; 1867.0bp to feature; MODIFIER silent_mutation Average:86.175; most accessible tissue: Callus, score: 96.111 N N N N
vg0920872974 T -> TAAAA LOC_Os09g36200-LOC_Os09g36210 intergenic_region ; MODIFIER silent_mutation Average:86.175; most accessible tissue: Callus, score: 96.111 N N N N
vg0920872974 T -> A LOC_Os09g36200.1 upstream_gene_variant ; 1866.0bp to feature; MODIFIER silent_mutation Average:86.175; most accessible tissue: Callus, score: 96.111 N N N N
vg0920872974 T -> A LOC_Os09g36200-LOC_Os09g36210 intergenic_region ; MODIFIER silent_mutation Average:86.175; most accessible tissue: Callus, score: 96.111 N N N N
vg0920872974 T -> TAAA LOC_Os09g36200.1 upstream_gene_variant ; 1867.0bp to feature; MODIFIER silent_mutation Average:86.175; most accessible tissue: Callus, score: 96.111 N N N N
vg0920872974 T -> TAAA LOC_Os09g36200-LOC_Os09g36210 intergenic_region ; MODIFIER silent_mutation Average:86.175; most accessible tissue: Callus, score: 96.111 N N N N
vg0920872974 T -> TA LOC_Os09g36200.1 upstream_gene_variant ; 1867.0bp to feature; MODIFIER silent_mutation Average:86.175; most accessible tissue: Callus, score: 96.111 N N N N
vg0920872974 T -> TA LOC_Os09g36200-LOC_Os09g36210 intergenic_region ; MODIFIER silent_mutation Average:86.175; most accessible tissue: Callus, score: 96.111 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0920872974 T A -0.02 -0.01 -0.01 -0.02 -0.02 -0.02
vg0920872974 T TA -0.03 -0.07 -0.05 -0.08 -0.08 -0.1
vg0920872974 T TAA -0.08 -0.09 -0.05 -0.08 -0.08 -0.1
vg0920872974 T TAAA -0.1 -0.08 -0.08 -0.06 -0.06 -0.1
vg0920872974 T TAAAA -0.27 -0.2 -0.2 -0.1 -0.16 -0.22

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920872974 NA 8.18E-07 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 1.44E-15 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 8.87E-06 mr1013_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 6.42E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 7.72E-09 mr1072_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 7.46E-08 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 7.58E-08 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 2.07E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 1.02E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 6.15E-10 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 5.31E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 1.23E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 1.11E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 4.23E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 4.28E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 2.45E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 2.15E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 5.25E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 2.79E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 1.61E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 3.07E-09 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 8.15E-07 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920872974 NA 4.05E-20 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251