Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920840396:

Variant ID: vg0920840396 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20840396
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTGCTGCGAGAGAGAGAAAGAGAGTCGAGGGGAAAAGGCAGGGTACAGTTGCCGGCTGCCTCACCCCTCTCTCTCTCTCTCTCTCTCGTTCTGAATAC[A/G]
GTTAGCTGGTTGGAATGTACTGTACTGTACTGTACTGCACTGCTACTAGCTGCATGCAGCATGCGACCCCGGGGTGGAGTTAATTGCCCGCGCCGTATGC

Reverse complement sequence

GCATACGGCGCGGGCAATTAACTCCACCCCGGGGTCGCATGCTGCATGCAGCTAGTAGCAGTGCAGTACAGTACAGTACAGTACATTCCAACCAGCTAAC[T/C]
GTATTCAGAACGAGAGAGAGAGAGAGAGAGAGGGGTGAGGCAGCCGGCAACTGTACCCTGCCTTTTCCCCTCGACTCTCTTTCTCTCTCTCGCAGCAGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 48.10% 0.42% 0.00% NA
All Indica  2759 85.80% 13.60% 0.65% 0.00% NA
All Japonica  1512 0.20% 99.70% 0.07% 0.00% NA
Aus  269 11.90% 88.10% 0.00% 0.00% NA
Indica I  595 90.30% 8.10% 1.68% 0.00% NA
Indica II  465 85.60% 14.00% 0.43% 0.00% NA
Indica III  913 85.50% 14.50% 0.00% 0.00% NA
Indica Intermediate  786 82.80% 16.40% 0.76% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 98.80% 0.41% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 25.60% 73.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920840396 A -> G LOC_Os09g36160.1 upstream_gene_variant ; 104.0bp to feature; MODIFIER silent_mutation Average:91.852; most accessible tissue: Minghui63 panicle, score: 98.699 N N N N
vg0920840396 A -> G LOC_Os09g36170.1 downstream_gene_variant ; 3613.0bp to feature; MODIFIER silent_mutation Average:91.852; most accessible tissue: Minghui63 panicle, score: 98.699 N N N N
vg0920840396 A -> G LOC_Os09g36160-LOC_Os09g36170 intergenic_region ; MODIFIER silent_mutation Average:91.852; most accessible tissue: Minghui63 panicle, score: 98.699 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0920840396 A G 0.11 0.08 0.06 -0.01 0.05 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920840396 NA 3.51E-21 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 6.15E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 4.97E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 1.65E-21 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 2.46E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 5.59E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 1.07E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 7.95E-06 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 9.72E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 4.94E-06 mr1765 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 1.06E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 9.34E-29 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 1.65E-08 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 3.73E-06 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 2.37E-34 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 2.58E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 4.12E-45 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920840396 NA 7.96E-06 mr1793_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251