\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0920825892:

Variant ID: vg0920825892 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 20825892
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.25, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTCGTCGGGACCTAGGAAAACGGAATCATCTTGTTGTCGGGGTTTCGTTTTTCTAGTTTTCAGAAGTTTTTGTCGGTCGGTTTTGGAGTTGCTGAGTT[A/G]
CATCAAGGGTTTGTCGTCTGTATTCGGCCGTGCTTGTTTCTCTTGCGCGAGGAAGAGGAGAGAGAAAAGATAACAGATCTGTTTTTGGAGGAAGTTTTGC

Reverse complement sequence

GCAAAACTTCCTCCAAAAACAGATCTGTTATCTTTTCTCTCTCCTCTTCCTCGCGCAAGAGAAACAAGCACGGCCGAATACAGACGACAAACCCTTGATG[T/C]
AACTCAGCAACTCCAAAACCGACCGACAAAAACTTCTGAAAACTAGAAAAACGAAACCCCGACAACAAGATGATTCCGTTTTCCTAGGTCCCGACGACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 40.20% 4.61% 0.00% NA
All Indica  2759 87.60% 9.10% 3.30% 0.00% NA
All Japonica  1512 0.50% 99.30% 0.20% 0.00% NA
Aus  269 57.20% 1.90% 40.89% 0.00% NA
Indica I  595 88.70% 8.40% 2.86% 0.00% NA
Indica II  465 88.80% 7.10% 4.09% 0.00% NA
Indica III  913 88.60% 9.10% 2.30% 0.00% NA
Indica Intermediate  786 84.70% 10.90% 4.33% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 96.30% 1.24% 0.00% NA
VI/Aromatic  96 8.30% 87.50% 4.17% 0.00% NA
Intermediate  90 24.40% 64.40% 11.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0920825892 A -> G LOC_Os09g36150.1 upstream_gene_variant ; 1371.0bp to feature; MODIFIER silent_mutation Average:19.336; most accessible tissue: Zhenshan97 root, score: 58.674 N N N N
vg0920825892 A -> G LOC_Os09g36140-LOC_Os09g36150 intergenic_region ; MODIFIER silent_mutation Average:19.336; most accessible tissue: Zhenshan97 root, score: 58.674 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0920825892 NA 5.93E-07 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 NA 2.83E-06 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 1.42E-06 NA mr1219 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 NA 1.15E-08 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 NA 2.63E-07 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 NA 2.42E-21 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 NA 6.09E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 NA 1.55E-36 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 NA 1.16E-21 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 NA 2.56E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 NA 7.01E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 NA 4.30E-21 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 NA 1.90E-06 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 2.50E-07 NA mr1219_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 1.76E-06 1.56E-08 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 1.58E-06 NA mr1274_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 7.33E-07 1.37E-08 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 NA 5.65E-19 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 NA 7.94E-24 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 NA 2.20E-07 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0920825892 NA 7.46E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251